User: vigneshnivas09

Reputation:
10
Status:
New User
Location:
India
Last seen:
2 years, 1 month ago
Joined:
4 years, 2 months ago
Email:
v*************@gmail.com

Posts by vigneshnivas09

<prev • 22 results • page 1 of 3 • next >
0
votes
0
answers
640
views
0
answers
How reliable is ClusPro for protein-protein docking?
... I have performed protein-protein docking and i have got 10 different models from ClusPro. I do not know whether they are accurate. Can anyone help? how to find binding energy value in clusPro ? after dock next step i have need for protein protein interaction binding residues? ...
docking written 2.1 years ago by vigneshnivas0910
0
votes
0
answers
557
views
0
answers
modelling-Protein specified in ALIGN_CODES(i) was not found in the alignment file
... how to clear this error modeller.ModellerError: read_al_373E> Protein specified in ALIGN_CODES(i) was not found in the alignment file; ALIGN_CODES( 1) = 3hy5. ...
alignment written 2.1 years ago by vigneshnivas0910 • updated 2.0 years ago by Biostar ♦♦ 20
0
votes
0
answers
584
views
0
answers
Comment: C: literature search in DbSNP
... hai frd, RLBP1 gene in mutation (missense mutation) and not for the link . only shown as in Varview Protein3D . i have need for in PubMed .https://www.ncbi.nlm.nih.gov/snp/?term=(RLBP1+) see this link ...
written 2.2 years ago by vigneshnivas0910
0
votes
0
answers
584
views
0
answers
literature search in DbSNP
... hai frds, I am using the DBsnp database how to find the literature paper? Filters activated: Homo sapiens, missense. Clear all to show 12252 items. Select item 28933990 1. rs28933990 [Homo sapiens] GTCACCGCAGGATTCCTTCCCAGCC[C/T]GGTTCAAAGCCATCCACTTCATCCA Chromosome: 15:89210794 Gene ...
rna-seq written 2.2 years ago by vigneshnivas0910
0
votes
1
answer
2.7k
views
1
answers
Comment: C: how to perl module install
... **strong text**same problem .pls help as Can't locate strict.pm in @INC (you may need to install the strict module) (@INC contains: /usr/local/lib/perl5/site_perl/5.18.2/x86_64-linux /usr/local/lib/perl5/site_perl/5.18.2 /storage/mayank/perlinstallation/lib/perl5/5.18.2/x86_64-linux /storage/mayank ...
written 2.2 years ago by vigneshnivas0910
0
votes
1
answer
2.7k
views
1
answers
Comment: A: how to perl module install
... linux system -sever centos per-wget http://search.cpan.org/CPAN/authors/id/R/RJ/RJBS/perl-5.25.0.tar.gz tar xvzf perl-5.25.0.tar.gz ...
written 2.2 years ago by vigneshnivas0910
0
votes
0
answers
1.6k
views
0
answers
Comment: C: how to install perl uisng strict.pm?
... how to install the string:: Approx in perl module? ...
written 2.2 years ago by vigneshnivas0910
0
votes
0
answers
1.6k
views
0
answers
(Closed) how to install perl uisng strict.pm?
... how to install the perl-5.24.0.tar.gz in centos? this for problem can't locate strict.pm in @INC (@INC contains: /usr/local/lib/perl5/5.8.0/i686-linux /usr/local/lib/perl5/5.8.0 /usr/local/lib/perl5/site_perl/5.8.0/i686-linux /usr/local/lib/perl5/site_perl/5.8.0 /usr/local/lib/perl5/site_perl .) ...
rna-seq written 2.2 years ago by vigneshnivas0910
1
vote
1
answer
2.7k
views
1
answer
(Closed) how to perl module install
... how to install the string:: approx ? cpan String::Approx module Can't locate strict.pm in @INC (you may need to install the strict module) (@INC contains: /usr/local/lib/perl5/site_perl/5.18.2/x86_64-linux /usr/local/lib/perl5/site_perl/5.18.2 /storage/mayank/perlinstallation/lib/perl5/5.18 ...
rna-seq written 2.2 years ago by vigneshnivas0910 • updated 2.2 years ago by krushnach80470
0
votes
3
answers
832
views
3
answers
Comment: C: Is It Fastq Format
... i will install this software but not working , no file such or directory sir sir please help me ...
written 2.2 years ago by vigneshnivas0910

Latest awards to vigneshnivas09

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1109 users visited in the last hour