User: vigneshnivas09

New User
Last seen:
2 years, 10 months ago
4 years, 11 months ago

Posts by vigneshnivas09

<prev • 22 results • page 1 of 3 • next >
How reliable is ClusPro for protein-protein docking?
... I have performed protein-protein docking and i have got 10 different models from ClusPro. I do not know whether they are accurate. Can anyone help? how to find binding energy value in clusPro ? after dock next step i have need for protein protein interaction binding residues? ...
docking written 2.8 years ago by vigneshnivas0910
modelling-Protein specified in ALIGN_CODES(i) was not found in the alignment file
... how to clear this error modeller.ModellerError: read_al_373E> Protein specified in ALIGN_CODES(i) was not found in the alignment file; ALIGN_CODES( 1) = 3hy5. ...
alignment written 2.9 years ago by vigneshnivas0910 • updated 2.7 years ago by Biostar ♦♦ 20
Comment: C: literature search in DbSNP
... hai frd, RLBP1 gene in mutation (missense mutation) and not for the link . only shown as in Varview Protein3D . i have need for in PubMed . see this link ...
written 2.9 years ago by vigneshnivas0910
literature search in DbSNP
... hai frds, I am using the DBsnp database how to find the literature paper? Filters activated: Homo sapiens, missense. Clear all to show 12252 items. Select item 28933990 1. rs28933990 [Homo sapiens] GTCACCGCAGGATTCCTTCCCAGCC[C/T]GGTTCAAAGCCATCCACTTCATCCA Chromosome: 15:89210794 Gene ...
rna-seq written 2.9 years ago by vigneshnivas0910
Comment: C: how to perl module install
... **strong text**same problem .pls help as Can't locate in @INC (you may need to install the strict module) (@INC contains: /usr/local/lib/perl5/site_perl/5.18.2/x86_64-linux /usr/local/lib/perl5/site_perl/5.18.2 /storage/mayank/perlinstallation/lib/perl5/5.18.2/x86_64-linux /storage/mayank ...
written 2.9 years ago by vigneshnivas0910
Comment: A: how to perl module install
... linux system -sever centos per-wget tar xvzf perl-5.25.0.tar.gz ...
written 2.9 years ago by vigneshnivas0910
Comment: C: how to install perl uisng
... how to install the string:: Approx in perl module? ...
written 2.9 years ago by vigneshnivas0910
(Closed) how to install perl uisng
... how to install the perl-5.24.0.tar.gz in centos? this for problem can't locate in @INC (@INC contains: /usr/local/lib/perl5/5.8.0/i686-linux /usr/local/lib/perl5/5.8.0 /usr/local/lib/perl5/site_perl/5.8.0/i686-linux /usr/local/lib/perl5/site_perl/5.8.0 /usr/local/lib/perl5/site_perl .) ...
rna-seq written 2.9 years ago by vigneshnivas0910
(Closed) how to perl module install
... how to install the string:: approx ? cpan String::Approx module Can't locate in @INC (you may need to install the strict module) (@INC contains: /usr/local/lib/perl5/site_perl/5.18.2/x86_64-linux /usr/local/lib/perl5/site_perl/5.18.2 /storage/mayank/perlinstallation/lib/perl5/5.18 ...
rna-seq written 2.9 years ago by vigneshnivas0910 • updated 2.9 years ago by krushnach80630
Comment: C: Is It Fastq Format
... i will install this software but not working , no file such or directory sir sir please help me ...
written 2.9 years ago by vigneshnivas0910

Latest awards to vigneshnivas09

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 885 users visited in the last hour