User: nikhilvgbt

gravatar for nikhilvgbt
nikhilvgbt0
Reputation:
0
Status:
New User
Last seen:
3 years, 1 month ago
Joined:
4 years, 5 months ago
Email:
n*********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by nikhilvgbt

<prev • 34 results • page 1 of 4 • next >
0
votes
0
answers
972
views
0
answers
target selection of differentially expressed miRNAs from NGS data analysis
... Well, I have got the differentially expressed miRNAs from NGS data analysis. Since, in this case, I only got the list of miRNA names and I don't have real sequences.. e.g MIR34, MIR211 etc and i wanted to find target gene for those miRNAs,,,, eventually i found that there are 3p and 5p different nam ...
mirna targets rna-seq mirnas written 3.1 years ago by nikhilvgbt0
0
votes
2
answers
4.4k
views
2
answers
Comment: C: microRNA target finding : 3p vs 5p?
... Hello, illinois.ks... how did you do this analysis, as i have got the miRNA from NGS data, I only got the list of miRNA names and I don't have real sequences, e.g MIR34, MIR211 etc and i wanted to find target ,,,, should i consider both 3p or 5p for MIR34 ??.. ...
written 3.1 years ago by nikhilvgbt0
0
votes
0
answers
1.5k
views
0
answers
Comment: C: Tophat unable to produce accepted_hits.bam file for single end read data
... HellO andrew.j.skelton73 and Devon Ryan sir, This is my log file content which tells about successfully completion of alignment, but still the accepted_hit.bam is of 1kb [2016-01-22 00:57:24] Beginning TopHat run (v2.0.9) ----------------------------------------------- [2016-01-22 00:57:24] Checki ...
written 3.4 years ago by nikhilvgbt0
0
votes
0
answers
1.5k
views
0
answers
Comment: C: Tophat unable to produce accepted_hits.bam file for single end read data
... There was no error while running tophat, the Tophat ran successfully for 2 hours using above command .. ...
written 3.4 years ago by nikhilvgbt0
0
votes
0
answers
1.5k
views
0
answers
Tophat unable to produce accepted_hits.bam file for single end read data
... I have been working on RNA-Seq data from last 6 months, and i am able to crate accepted_hits.bam file for paired end data, but i am not able to create the accepted_hits.bam file for single end data using Tophat. The commad line i used for single end data is: Tophat -p 12 -G hg19.gtf -o C1_R1_thout ...
tophat rna-seq written 3.4 years ago by nikhilvgbt0
0
votes
4
answers
23k
views
4
answers
Comment: C: Trimming Adapters For Paired-End Sequences
... Hi samsara; first of all i would say thanks for your comment... I am new in RNA-seq ... i have data Illumina hi-seq 2000, i used the fastqc to check quality so i found that there are overrepresented sequence in it. read1:-GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC read2:-GATCGGAAGAGCGTCG ...
written 4.3 years ago by nikhilvgbt0
0
votes
2
answers
4.9k
views
2
answers
Comment: C: cufflink and cuffmerge error
... Yeah... it worked for me... the problem in the bam file is just because there is no proper order of Chromosomes in Reference genome and Gtf file.... thank you... komal.rathi...  and  komal.rathi... how did you solve this error... so that other people may have an answer for this.... ...
written 4.4 years ago by nikhilvgbt0
0
votes
2
answers
4.9k
views
2
answers
Comment: C: cufflink and cuffmerge error
... yeah, i got the output from tophat and cufflinks,and the assembly.txt file has all the transcript.gtf files.... if i run the cuffmerge the following error has occurred.. my error: [bam_header_read] EOF marker is absent. The input is probably truncated. [bam_header_read] invalid BAM binary header ( ...
written 4.4 years ago by nikhilvgbt0
0
votes
2
answers
4.9k
views
2
answers
Comment: C: cufflink and cuffmerge error
... Hi sbdk82 and  komal.rathi; i checked the gtf file too... i changed my gtf file also and tried once again but still same error its giving.....   ...
written 4.4 years ago by nikhilvgbt0
0
votes
0
answers
3.0k
views
0
answers
Comment: C: cuffmerge error for loading annotation file
... hi RamRS;  i checked that in forum and i tried accordingly but still same error... as far as i understood there is problem in the output of tophat which is .bam file or else output of the Cufflinks ... ...
written 4.4 years ago by nikhilvgbt0

Latest awards to nikhilvgbt

Popular Question 4.3 years ago, created a question with more than 1,000 views. For trim galore and cutadapt software errors
Popular Question 4.3 years ago, created a question with more than 1,000 views. For Tophat error : Error: gtf_to_fasta returned an error.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 928 users visited in the last hour