User: juan.crescente

Reputation:
20
Status:
New User
Location:
Last seen:
1 week, 5 days ago
Joined:
3 years, 9 months ago
Email:
j*************@gmail.com

Posts by juan.crescente

<prev • 49 results • page 1 of 5 • next >
1
vote
1
answer
179
views
1
answers
Answer: A: hisat2 / bowtie: read has more quality values than read characters
... I could verify with gzip -t R2.fq.gz && echo ok || echo bad that the file was corrupted. For some reason the reads were not in the correct line. Re-downloading the file solved the issue. ...
written 4 weeks ago by juan.crescente20
0
votes
1
answer
179
views
1
answers
Comment: C: hisat2 / bowtie: read has more quality values than read characters
... you're right! @J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT CTCGGAGCCACTCTTGGCCTCCCGGGAGCTGATGTAAGGCCCTTAGGGAA + AAFFFJJAJJJJJJJJGGCGTGTACCAGTTTGTAGACAAGTACGGTGCCAACGTCGACGGCTAC + AAFFFJJJJJJJJJJJJJ1TGT TTCCCTTTJJJJJ1TGT TTCCCTJJ Indeed the record seem odd! ...
written 4 weeks ago by juan.crescente20
0
votes
1
answer
179
views
1
answers
Comment: C: hisat2 / bowtie: read has more quality values than read characters
... I don't. This is the command I'm using ./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrc ...
written 4 weeks ago by juan.crescente20
0
votes
1
answer
179
views
1
answers
Comment: C: hisat2 / bowtie: read has more quality values than read characters
... I have 32 GB of RAM. The line seems fine: @J00113:78:H3JKNBBXX:3:2209:5670:22819 1:N:0:ATCACG CCATGATCTTAGTTTCTGGCGCTCGTTCGTCGCGAAATAAGCCGAGGTGT + ...
written 4 weeks ago by juan.crescente20
2
votes
1
answer
179
views
1
answer
hisat2 / bowtie: read has more quality values than read characters
... I'm struggling with this issue: ./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrcv/genes ...
bowtie2 hisat2 bowtie hisat written 5 weeks ago by juan.crescente20
0
votes
0
answers
332
views
0
answers
Comment: C: bowtie2-build index files missing
... So the seg fault was when running bowtie2, not build. Maybe build was killed and did not finish. I'll re-run and update results in a few days. ...
written 4 months ago by juan.crescente20
0
votes
0
answers
332
views
0
answers
Comment: C: bowtie2-build index files missing
... Can I specify the memory in the job? What about this error? Could not open index file refseq.rev.1.bt2l ...
written 4 months ago by juan.crescente20
0
votes
0
answers
332
views
0
answers
Comment: C: bowtie2-build index files missing
... 47GB is the RAM in the machine, can I increase the assigned memory? ...
written 4 months ago by juan.crescente20
3
votes
0
answers
332
views
0
answers
bowtie2-build index files missing
... I'm trying to use bowtie2 for mapping reads agains a large genome (17Gb). I'm getting an error. It seems like an issue in the index / or some files missing: ./bowtie2 -x refseq -1w_paired.fq -2 rv_paired.fq -S outrefseq --no-unal Could not open index file refseq.rev.1.bt2l Could not ope ...
bowtie2 bowtie-build mapping bowtie2-build written 4 months ago by juan.crescente20
2
votes
1
answer
236
views
1
answers
Answer: A: Odd max query limit in BLAT
... As responded by UCSC itself: > The 32 results are indeed a consistent limitation where BLAT only > allows 16 results per chromosome and per strand. BLAT is unable to > exhaustively return results for queries with repetitive sequences that > map to many places in the genome. There may b ...
written 4 months ago by juan.crescente20

Latest awards to juan.crescente

Scholar 4 weeks ago, created an answer that has been accepted. For A: Odd max query limit in BLAT
Scholar 4 months ago, created an answer that has been accepted. For A: Odd max query limit in BLAT

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2257 users visited in the last hour