User: juan.crescente

Reputation:
20
Status:
New User
Location:
Last seen:
1 day, 3 hours ago
Joined:
4 years, 1 month ago
Email:
j*************@gmail.com

Posts by juan.crescente

<prev • 52 results • page 1 of 6 • next >
0
votes
1
answer
88
views
1
answers
Comment: C: How to get cigar string from bwa or bowtie
... is there a way to get a string represeting the alignment straightforward like MATCH-MATCH-MISMATCH ...
written 11 days ago by juan.crescente20
0
votes
1
answer
88
views
1
answers
Comment: C: How to get cigar string from bwa or bowtie
... I see, with bwa mem. What about the CIGAR in bowtie? ...
written 11 days ago by juan.crescente20
1
vote
1
answer
88
views
1
answer
How to get cigar string from bwa or bowtie
... I have two sequenes and I want to get the CIGAR string of a local alignment. I've tried with bwa and bowtie The first one give me this, all *. When I change a nucleotide in the query, all it does is change the sequence reported in the output (8th column), but nothing else! $ ./bwa mem ../se ...
bowtie written 11 days ago by juan.crescente20 • updated 11 days ago by Santosh Anand4.6k
1
vote
1
answer
491
views
1
answers
Answer: A: hisat2 / bowtie: read has more quality values than read characters
... I could verify with gzip -t R2.fq.gz && echo ok || echo bad that the file was corrupted. For some reason the reads were not in the correct line. Re-downloading the file solved the issue. ...
written 4 months ago by juan.crescente20
0
votes
1
answer
491
views
1
answers
Comment: C: hisat2 / bowtie: read has more quality values than read characters
... you're right! @J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT CTCGGAGCCACTCTTGGCCTCCCGGGAGCTGATGTAAGGCCCTTAGGGAA + AAFFFJJAJJJJJJJJGGCGTGTACCAGTTTGTAGACAAGTACGGTGCCAACGTCGACGGCTAC + AAFFFJJJJJJJJJJJJJ1TGT TTCCCTTTJJJJJ1TGT TTCCCTJJ Indeed the record seem odd! ...
written 5 months ago by juan.crescente20
0
votes
1
answer
491
views
1
answers
Comment: C: hisat2 / bowtie: read has more quality values than read characters
... I don't. This is the command I'm using ./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrc ...
written 5 months ago by juan.crescente20
0
votes
1
answer
491
views
1
answers
Comment: C: hisat2 / bowtie: read has more quality values than read characters
... I have 32 GB of RAM. The line seems fine: @J00113:78:H3JKNBBXX:3:2209:5670:22819 1:N:0:ATCACG CCATGATCTTAGTTTCTGGCGCTCGTTCGTCGCGAAATAAGCCGAGGTGT + ...
written 5 months ago by juan.crescente20
2
votes
1
answer
491
views
1
answer
hisat2 / bowtie: read has more quality values than read characters
... I'm struggling with this issue: ./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrcv/genes ...
bowtie2 hisat2 bowtie hisat written 5 months ago by juan.crescente20
0
votes
0
answers
539
views
0
answers
Comment: C: bowtie2-build index files missing
... So the seg fault was when running bowtie2, not build. Maybe build was killed and did not finish. I'll re-run and update results in a few days. ...
written 8 months ago by juan.crescente20
0
votes
0
answers
539
views
0
answers
Comment: C: bowtie2-build index files missing
... Can I specify the memory in the job? What about this error? Could not open index file refseq.rev.1.bt2l ...
written 8 months ago by juan.crescente20

Latest awards to juan.crescente

Popular Question 10 days ago, created a question with more than 1,000 views. For How to count fasta sequences efficiently using (or not ) biopython
Scholar 4 months ago, created an answer that has been accepted. For A: Odd max query limit in BLAT
Scholar 8 months ago, created an answer that has been accepted. For A: Odd max query limit in BLAT

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 812 users visited in the last hour