User: rus2dil

gravatar for rus2dil
New User
Sri Lanka
Last seen:
5 years ago
5 years, 3 months ago

Posts by rus2dil

<prev • 14 results • page 1 of 2 • next >
Comment: C: Promoter Motifs (+) and (-) strands
... Thank you very much for the information. I will look into that ...
written 5.1 years ago by rus2dil20
Promoter Motifs (+) and (-) strands
... Hello, I have been researching on putative motif on a promoter region. PLACE ( signal scan gave me results like this.   (+) = Current Strand (-) = Opposite Strand 1 TGTGCCCACCACAGCACACCTATCGTTATCATCAGCGTGGACTAAGAACA ( ...
motif promoter signal scan written 5.1 years ago by rus2dil20 • updated 5.1 years ago by mark.ziemann1.2k
Comment: C: Multiple fasta to one fasta in galaxy
... It is because after mapping with BWA, generated pile up, the converted to fasta, which resulted single fasta file with multiple sequences. ...
written 5.2 years ago by rus2dil20
Multiple fasta to one fasta in galaxy
... I have something like this >Chr6 C >Chr6 A >Chr6 C >Chr6 A >Chr6 T >Chr6 C I need something like this >Chr6 CACATC Need to use galaxy ...
fasta convertion galaxy sequence sequencing written 5.2 years ago by rus2dil20 • updated 5.2 years ago by Jennifer Hillman Jackson390
From aligened sliced and filtered bam to single sequence in fasts format
... Hello, I have mapped 6 paired illumina raw reads against a reference genome and filtered by mapping quality and chromosome number 6. Then sliced using predefined coordinates of a gene region and merged the resulting bam files. Now I have a bam file of newly mapped genome only within the coordinates ...
assembly galaxy written 5.2 years ago by rus2dil20 • updated 5.2 years ago by Jennifer Hillman Jackson390
Comment: C: What are the steps to follow to extract a promoter region starting from illumina
... I have WGS unaligned raw reads. I need to extract the promoter region of a particular gene. I would like to know the steps from the scratch or a link to learn the process. Thanks ...
written 5.3 years ago by rus2dil20
What are the steps to follow to extract a promoter region starting from illumina 2000 fastq read
... What are the steps to follow to extract a promoter region starting from illumina 2000 fastq read? I am new to this and I want to use galaxy platform. ...
assembly alignment promoter written 5.3 years ago by rus2dil20 • updated 5.3 years ago by Fidel1.9k
Comment: A: How to merge sequences in a BAM file to one sequence?
... Yes, that's right. I am new to this ...
written 5.3 years ago by rus2dil20
How to merge sequences in a BAM file to one sequence?
... I have an aligned BAM file and I need to merge all the sequences inside to one sequence. How should I do it? in Galaxy? ...
assembly alignment consensus sequence written 5.3 years ago by rus2dil20 • updated 5.3 years ago by Devon Ryan95k
Are these steps correct? Galaxy
... I have aligned NGS six runs of a sample using BWA (galaxy platform). Then I merged them into one BAM file. Next I sliced the region of interest using SliceBAM in BED tools. After that I merged sequences in the resulting file using Merge command in Operate on Genomic Intervals. So the final result is ...
assembly next-gen alignment sequencing written 5.3 years ago by rus2dil20 • updated 5.3 years ago by marina.v.yurieva510

Latest awards to rus2dil

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1647 users visited in the last hour