User: rice.researcher

gravatar for rice.researcher
Reputation:
140
Status:
Trusted
Location:
Korea, Republic Of
Last seen:
11 months ago
Joined:
4 years, 9 months ago
Email:
r**************@gmail.com

Posts by rice.researcher

<prev • 33 results • page 1 of 4 • next >
1
vote
0
answers
470
views
0
answers
How to eliminate batch effect using removeBatchEffect function for tissue expression profiles?
... For meta-analysis work, I would like to combine two rice GEO series( [GSE27988][1] and [GSE27856][2] ) where each series analyze multiple anatomical tissue related expression profiles.To eliminate batch effect, I'm not sure whether I can use limma [removeBatchEffect][3] function as given below. Si ...
R batch-effect microarray limma written 14 months ago by rice.researcher140 • updated 14 months ago by zx87548.8k
2
votes
0
answers
798
views
0
answers
Comment: C: Extract specific information from BLASTn output
... You can format the BLAST output using [-outfmt][1]. -outfmt 6 will give you tabular format. [1]: https://www.biostars.org/p/88944/ ...
written 14 months ago by rice.researcher140
0
votes
2
answers
1.6k
views
2
answers
Comment: C: Unable to map genes to KEGG pathway using pathview
... Thanks,.! Yes, image for corresponding pathway is being generated. But none of the input genes are mapped to the generated pathway image. (To test purpose, I used two genes in the pathway 00195. So these two genes with highlighted red box in the pathway image is the expected result.) ...
written 15 months ago by rice.researcher140
0
votes
2
answers
1.6k
views
2
answers
Comment: C: Unable to map genes to KEGG pathway using pathview
... Sorry, I used exactly the same code which you have given. library("pathview") geneList <- c("Os03t0659266-00", "Os04t0473150-00") pathview(gene.data = geneList, pathway.id = "00195", gene.idtype = "KEGG", species = "Oryza sativa japonica") ...
written 15 months ago by rice.researcher140
0
votes
2
answers
1.6k
views
2
answers
Comment: C: Unable to map genes to KEGG pathway using pathview
... Thanks for your help. I tried with gene.idtype = "KEGG". But it not mapping the genes and throws warnings like, Warning: None of the genes or compounds mapped to the pathway! Argument gene.idtype or cpd.idtype may be wrong. Warning: No annotation package for the species osa, gene symbol ...
written 15 months ago by rice.researcher140
5
votes
2
answers
1.6k
views
5 follow
2
answers
Unable to map genes to KEGG pathway using pathview
... I was trying to map a list of genes to Oryza sativa (rice) KEGG pathways using [pathview][1] R package. But failed to map genes. I followed [this][2] tutorial. For example, the code below library("pathview") geneList<-read.table("genes.txt",header=T,sep="\t") pathway <- pathv ...
R bioconductor oryza sativa kegg clusterprofiler written 15 months ago by rice.researcher140 • updated 14 months ago by bigmawen340
1
vote
1
answer
594
views
5 follow
1
answer
Tool or package to make a plot of multiple species GO comparison
... I wanted to plot GO enrichment results of multiple species (10) to compare the enriched terms. Can anyone suggest tool or package for my purpose? An example of the desired plot is below. ![enter image description here][1] [1]: https://image.ibb.co/hZgpZp/GO_multiple.jpg ...
package gene ontology visualization tool go written 16 months ago by rice.researcher140 • updated 11 months ago by matz0
0
votes
1
answer
572
views
1
answers
Comment: C: How to trim adapters from fastq having 8mer+8mer bar-code
... Thanks @Devon for the suggestion.! BTW, I' not sure how the 8mer+8mer case come? If you could give a search keyword for this kind of barcoding, it would be helpful for me to further look into to available documents. ...
written 19 months ago by rice.researcher140
3
votes
1
answer
572
views
1
answer
How to trim adapters from fastq having 8mer+8mer bar-code
... I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex, @K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA + A,A,F ...
illumina ngs fastq adapter barcode written 19 months ago by rice.researcher140 • updated 19 months ago by Devon Ryan93k
0
votes
3
answers
428
views
3
answers
Answer: A: microarray data analysis
... You can try Shiny app [BatchQC][1]. It can deal with multiple batches and eliminate batch effect. [1]: https://bioconductor.org/packages/release/bioc/html/BatchQC.html ...
written 21 months ago by rice.researcher140

Latest awards to rice.researcher

Popular Question 11 months ago, created a question with more than 1,000 views. For Plotting and Visualizing large number of genes into chromsome
Scholar 2.4 years ago, created an answer that has been accepted. For A: How to plot Z-scores in R for gene expression data
Teacher 2.4 years ago, created an answer with at least 3 up-votes. For A: How to plot Z-scores in R for gene expression data
Popular Question 3.7 years ago, created a question with more than 1,000 views. For Plotting and Visualizing large number of genes into chromsome

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 723 users visited in the last hour