User: rice.researcher

Reputation:
90
Status:
Trusted
Location:
Korea, Republic Of
Last seen:
1 day, 23 hours ago
Joined:
3 years, 5 months ago
Email:
r**************@gmail.com

Posts by rice.researcher

<prev • 27 results • page 1 of 3 • next >
0
votes
0
answers
103
views
0
answers
Tool or package to make a plot of multiple species GO comparison
... I wanted to plot GO enrichment results of multiple species (10) to compare the enriched terms. Can anyone suggest tool or package for my purpose? An example of the desired plot is below. ![enter image description here][1] [1]: https://image.ibb.co/hZgpZp/GO_multiple.jpg ...
package gene ontology visualization tool go written 8 days ago by rice.researcher90 • updated 7 days ago by RamRS17k
0
votes
1
answer
175
views
1
answers
Comment: C: How to trim adapters from fastq having 8mer+8mer bar-code
... Thanks @Devon for the suggestion.! BTW, I' not sure how the 8mer+8mer case come? If you could give a search keyword for this kind of barcoding, it would be helpful for me to further look into to available documents. ...
written 3 months ago by rice.researcher90
3
votes
1
answer
175
views
1
answer
How to trim adapters from fastq having 8mer+8mer bar-code
... I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex, @K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA + A,A,F ...
illumina ngs fastq adapter barcode written 3 months ago by rice.researcher90 • updated 3 months ago by Devon Ryan84k
0
votes
3
answers
183
views
3
answers
Answer: A: microarray data analysis
... You can try Shiny app [BatchQC][1]. It can deal with multiple batches and eliminate batch effect. [1]: https://bioconductor.org/packages/release/bioc/html/BatchQC.html ...
written 5 months ago by rice.researcher90
0
votes
0
answers
660
views
0
answers
Comment: C: Meta-analysis: How to join data from different platforms
... Too late, but [this paper][1] describes what you are looking for. [1]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5697344/ ...
written 7 months ago by rice.researcher90
0
votes
1
answer
529
views
1
answers
Comment: C: Ballgown library load
... May be [this answer][1] will be helpful to solve the issue. [1]: https://stackoverflow.com/questions/31717850/error-package-or-namespace-load-failed-for-ggplot2-and-for-data-table ...
written 9 months ago by rice.researcher90
0
votes
2
answers
391
views
2
answers
Comment: C: multiple sequence alignment
... [mauve][1] and [VISTA][2]can be used to align genomes and to analyze synthetic regions. [1]: http://darlinglab.org/mauve/mauve.html [2]: http://genome.lbl.gov/vista/index.shtml ...
written 10 months ago by rice.researcher90
0
votes
1
answer
490
views
1
answers
Comment: C: Tools for viral metagenomics profiling and abundance estimation using BAM file
... Ok I got it, thanks!! ...
written 10 months ago by rice.researcher90
1
vote
1
answer
432
views
1
answers
Comment: C: Looking for publicly available dataset.
... [ArrayExpress][1] has number of processed data and filtering option may show dataset you are looking for. [1]: https://www.ebi.ac.uk/arrayexpress/browse.html ...
written 10 months ago by rice.researcher90
0
votes
0
answers
1.9k
views
0
answers
Comment: C: cuffdiff error "number of labels must match number of conditions"
... Previously I also faced this problem and a [solution][1] given in this thread by Devon Ryan solved it. [1]: https://www.biostars.org/p/129622/ ...
written 10 months ago by rice.researcher90

Latest awards to rice.researcher

Scholar 12 months ago, created an answer that has been accepted. For A: How to plot Z-scores in R for gene expression data
Teacher 12 months ago, created an answer with at least 3 up-votes. For A: How to plot Z-scores in R for gene expression data
Popular Question 2.4 years ago, created a question with more than 1,000 views. For Plotting and Visualizing large number of genes into chromsome

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 618 users visited in the last hour