User: rice.researcher

gravatar for rice.researcher
Korea, Republic Of
Last seen:
2 years ago
5 years, 11 months ago

Posts by rice.researcher

<prev • 33 results • page 1 of 4 • next >
How to eliminate batch effect using removeBatchEffect function for tissue expression profiles?
... For meta-analysis work, I would like to combine two rice GEO series( [GSE27988][1] and [GSE27856][2] ) where each series analyze multiple anatomical tissue related expression profiles.To eliminate batch effect, I'm not sure whether I can use limma [removeBatchEffect][3] function as given below. Si ...
R batch-effect microarray limma written 2.3 years ago by rice.researcher150 • updated 2.3 years ago by zx87549.9k
Comment: C: Extract specific information from BLASTn output
... You can format the BLAST output using [-outfmt][1]. -outfmt 6 will give you tabular format. [1]: ...
written 2.3 years ago by rice.researcher150
Comment: C: Unable to map genes to KEGG pathway using pathview
... Thanks,.! Yes, image for corresponding pathway is being generated. But none of the input genes are mapped to the generated pathway image. (To test purpose, I used two genes in the pathway 00195. So these two genes with highlighted red box in the pathway image is the expected result.) ...
written 2.4 years ago by rice.researcher150
Comment: C: Unable to map genes to KEGG pathway using pathview
... Sorry, I used exactly the same code which you have given. library("pathview") geneList <- c("Os03t0659266-00", "Os04t0473150-00") pathview( = geneList, = "00195", gene.idtype = "KEGG", species = "Oryza sativa japonica") ...
written 2.4 years ago by rice.researcher150
Comment: C: Unable to map genes to KEGG pathway using pathview
... Thanks for your help. I tried with gene.idtype = "KEGG". But it not mapping the genes and throws warnings like, Warning: None of the genes or compounds mapped to the pathway! Argument gene.idtype or cpd.idtype may be wrong. Warning: No annotation package for the species osa, gene symbol ...
written 2.4 years ago by rice.researcher150
5 follow
Unable to map genes to KEGG pathway using pathview
... I was trying to map a list of genes to Oryza sativa (rice) KEGG pathways using [pathview][1] R package. But failed to map genes. I followed [this][2] tutorial. For example, the code below library("pathview") geneList<-read.table("genes.txt",header=T,sep="\t") pathway <- pathv ...
R bioconductor oryza sativa kegg clusterprofiler written 2.4 years ago by rice.researcher150 • updated 2.3 years ago by bigmawen360
5 follow
Tool or package to make a plot of multiple species GO comparison
... I wanted to plot GO enrichment results of multiple species (10) to compare the enriched terms. Can anyone suggest tool or package for my purpose? An example of the desired plot is below. ![enter image description here][1] [1]: ...
package gene ontology visualization tool go written 2.5 years ago by rice.researcher150 • updated 2.0 years ago by matz0
Comment: C: How to trim adapters from fastq having 8mer+8mer bar-code
... Thanks @Devon for the suggestion.! BTW, I' not sure how the 8mer+8mer case come? If you could give a search keyword for this kind of barcoding, it would be helpful for me to further look into to available documents. ...
written 2.7 years ago by rice.researcher150
How to trim adapters from fastq having 8mer+8mer bar-code
... I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex, @K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA + A,A,F ...
illumina ngs fastq adapter barcode written 2.7 years ago by rice.researcher150 • updated 2.7 years ago by Devon Ryan98k
Answer: A: microarray data analysis
... You can try Shiny app [BatchQC][1]. It can deal with multiple batches and eliminate batch effect. [1]: ...
written 2.9 years ago by rice.researcher150

Latest awards to rice.researcher

Popular Question 2.0 years ago, created a question with more than 1,000 views. For Plotting and Visualizing large number of genes into chromsome
Scholar 3.5 years ago, created an answer that has been accepted. For A: How to plot Z-scores in R for gene expression data
Teacher 3.5 years ago, created an answer with at least 3 up-votes. For A: How to plot Z-scores in R for gene expression data
Popular Question 4.8 years ago, created a question with more than 1,000 views. For Plotting and Visualizing large number of genes into chromsome


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1661 users visited in the last hour