User: rice.researcher

Reputation:
90
Status:
Trusted
Location:
Korea, Republic Of
Last seen:
6 hours ago
Joined:
3 years, 2 months ago
Email:
r**************@gmail.com

Posts by rice.researcher

<prev • 26 results • page 1 of 3 • next >
0
votes
1
answer
80
views
1
answers
Comment: C: How to trim adapters from fastq having 8mer+8mer bar-code
... Thanks @Devon for the suggestion.! BTW, I' not sure how the 8mer+8mer case come? If you could give a search keyword for this kind of barcoding, it would be helpful for me to further look into to available documents. ...
written 11 days ago by rice.researcher90
3
votes
1
answer
80
views
1
answer
How to trim adapters from fastq having 8mer+8mer bar-code
... I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex, @K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA + A,A,F ...
illumina ngs fastq adapter barcode written 11 days ago by rice.researcher90 • updated 11 days ago by Devon Ryan81k
0
votes
3
answers
141
views
3
answers
Answer: A: microarray data analysis
... You can try Shiny app [BatchQC][1]. It can deal with multiple batches and eliminate batch effect. [1]: https://bioconductor.org/packages/release/bioc/html/BatchQC.html ...
written 8 weeks ago by rice.researcher90
0
votes
0
answers
555
views
0
answers
Comment: C: Meta-analysis: How to join data from different platforms
... Too late, but [this paper][1] describes what you are looking for. [1]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5697344/ ...
written 4 months ago by rice.researcher90
0
votes
1
answer
411
views
1
answers
Comment: C: Ballgown library load
... May be [this answer][1] will be helpful to solve the issue. [1]: https://stackoverflow.com/questions/31717850/error-package-or-namespace-load-failed-for-ggplot2-and-for-data-table ...
written 6 months ago by rice.researcher90
0
votes
2
answers
336
views
2
answers
Comment: C: multiple sequence alignment
... [mauve][1] and [VISTA][2]can be used to align genomes and to analyze synthetic regions. [1]: http://darlinglab.org/mauve/mauve.html [2]: http://genome.lbl.gov/vista/index.shtml ...
written 7 months ago by rice.researcher90
0
votes
1
answer
385
views
1
answers
Comment: C: Tools for viral metagenomics profiling and abundance estimation using BAM file
... Ok I got it, thanks!! ...
written 7 months ago by rice.researcher90
1
vote
1
answer
360
views
1
answers
Comment: C: Looking for publicly available dataset.
... [ArrayExpress][1] has number of processed data and filtering option may show dataset you are looking for. [1]: https://www.ebi.ac.uk/arrayexpress/browse.html ...
written 7 months ago by rice.researcher90
0
votes
0
answers
1.7k
views
0
answers
Comment: C: cuffdiff error "number of labels must match number of conditions"
... Previously I also faced this problem and a [solution][1] given in this thread by Devon Ryan solved it. [1]: https://www.biostars.org/p/129622/ ...
written 7 months ago by rice.researcher90
0
votes
2
answers
436
views
2
answers
Comment: C: How to integrate multiple data sets from microarray platform prior meta-analysis
... Very well explained !!. I am looking into it. ...
written 7 months ago by rice.researcher90

Latest awards to rice.researcher

Scholar 9 months ago, created an answer that has been accepted. For A: How to plot Z-scores in R for gene expression data
Teacher 9 months ago, created an answer with at least 3 up-votes. For A: How to plot Z-scores in R for gene expression data
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Plotting and Visualizing large number of genes into chromsome

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2072 users visited in the last hour