User: Azhar

gravatar for Azhar
Azhar40
Reputation:
40
Status:
New User
Location:
China
Last seen:
5 months, 2 weeks ago
Joined:
3 years, 8 months ago
Email:
A**********@gmail.com

Posts by Azhar

<prev • 110 results • page 1 of 11 • next >
0
votes
1
answer
297
views
1
answers
Comment: C: Blast or Blat for multiple sequence alignment to get each respective sequence lo
... Yes I can use bash commands, and blast in linux. your response is informative and i have used blast before, actually i want to use blat for miRNA sequence to get locations for each sequence for hg19. But the i have list of miRNA sequences, according to my information i have to make fasta file for th ...
written 5 months ago by Azhar40
0
votes
1
answer
297
views
1
answers
Comment: C: Blast or Blat for multiple sequence alignment to get each respective sequence lo
... can you just guide me how to do that i never did that just like step wise make a fasta file for 20K seq and run the blast using above stated options then get the locations I am confused about location, will i get the locations for each seq ...
written 5 months ago by Azhar40
1
vote
1
answer
297
views
1
answer
Blast or Blat for multiple sequence alignment to get each respective sequence locations
... I have almost 8000 small RNA sequences, i want to get their Top 20 possible locations using Blast or Blat, for each sequence. Is there any method or script which can be used, Kindly enlighten me ...
next-gen written 5 months ago by Azhar40 • updated 5 months ago by maxime.policarpo40
0
votes
0
answers
399
views
0
answers
Comment: C: link genome browser to locations
... Okay I noted thanks ...
written 10 months ago by Azhar40
0
votes
0
answers
399
views
0
answers
Comment: C: link genome browser to locations
... Thanks for your answer but my question is different.Regards ...
written 11 months ago by Azhar40
0
votes
0
answers
399
views
0
answers
Comment: C: link genome browser to locations
... i want my location to be as hyper link using a formula using http://genome.ucsc.edu/cgi-bin/hgTracks?org=[org]&db=[db]&position=[position] becuase i have number of locations so i want to make a formula so i click and drag easliy for eg chr3:150000-160000:- i want to make this hyper link ...
written 11 months ago by Azhar40
2
votes
0
answers
399
views
0
answers
link genome browser to locations
... Hi Hellow every one, I want to link my excel file with genomic locations, with genome browser and also upload in mysql to visualize, I think easy option is to make hyperlink by using http://genome.ucsc.edu/cgi-bin/hgTracks?org=[org]&db=[db]&posit ...
next-gen written 11 months ago by Azhar40
40
votes
2
answers
3.0k
views
10 follow
2
answers
FASTA file into excel file format?
... Hi, I have a NCBI fast seq file like >mrna1 gctatatagactgatagctag >mrna2 acgaggctagcggattg for whole Human genome and i want to convert it into excel file format for convenience in analysis or How this can be used in sql format to extract data Please ...
rna-seq written 15 months ago by Azhar40 • updated 15 months ago by Daniel3.7k
0
votes
0
answers
559
views
0
answers
Comment: C: Hypergeometric test ?
... Thanks May I Ask what OP means ? As far as i understand we have done DEG ,GO and other analysis so we want to find out Gene enrichment for disease associated genes in each class or group and see any biasness? ...
written 17 months ago by Azhar40
0
votes
1
answer
601
views
1
answers
Comment: C: sickle output explanation?
... Thanks Istvan Albert I understand that you said above i know offcourse we have to determine from fastqc report for trimming but my question is run the above mentioned command and there nothing happened for long time and then ihave to cntrl c . So my question is i dont know is it worked or not ? b ...
written 17 months ago by Azhar40

Latest awards to Azhar

Popular Question 10 months ago, created a question with more than 1,000 views. For Enhacers find out with Homer
Popular Question 10 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Popular Question 10 months ago, created a question with more than 1,000 views. For Bam file view in ucsc
Popular Question 10 months ago, created a question with more than 1,000 views. For Bowtie 2 error
Popular Question 10 months ago, created a question with more than 1,000 views. For Homer for NGS analysis
Popular Question 10 months ago, created a question with more than 1,000 views. For how to visulaize WGCNA network file in cytoscape
Popular Question 10 months ago, created a question with more than 1,000 views. For FASTA file into excel file format?
Popular Question 15 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Centurion 17 months ago, created 100 posts.
Popular Question 19 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Popular Question 21 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Popular Question 2.6 years ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Bowtie 2 error

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1201 users visited in the last hour