User: Azhar

gravatar for Azhar
Azhar20
Reputation:
20
Status:
New User
Location:
China
Last seen:
2 days, 5 hours ago
Joined:
2 years, 9 months ago
Email:
A**********@gmail.com

Posts by Azhar

<prev • 107 results • page 1 of 11 • next >
0
votes
0
answers
138
views
0
answers
Comment: C: link genome browser to locations
... Okay I noted thanks ...
written 2 days ago by Azhar20
0
votes
0
answers
138
views
0
answers
Comment: C: link genome browser to locations
... Thanks for your answer but my question is different.Regards ...
written 3 days ago by Azhar20
0
votes
0
answers
138
views
0
answers
Comment: C: link genome browser to locations
... i want my location to be as hyper link using a formula using http://genome.ucsc.edu/cgi-bin/hgTracks?org=[org]&db=[db]&position=[position] becuase i have number of locations so i want to make a formula so i click and drag easliy for eg chr3:150000-160000:- i want to make this hyper link ...
written 3 days ago by Azhar20
2
votes
0
answers
138
views
0
answers
link genome browser to locations
... Hi Hellow every one, I want to link my excel file with genomic locations, with genome browser and also upload in mysql to visualize, I think easy option is to make hyperlink by using http://genome.ucsc.edu/cgi-bin/hgTracks?org=[org]&db=[db]&posit ...
next-gen written 4 days ago by Azhar20
38
votes
2
answers
1.0k
views
8 follow
2
answers
FASTA file into excel file format?
... Hi, I have a NCBI fast seq file like >mrna1 gctatatagactgatagctag >mrna2 acgaggctagcggattg for whole Human genome and i want to convert it into excel file format for convenience in analysis or How this can be used in sql format to extract data Please ...
rna-seq written 4 months ago by Azhar20 • updated 4 months ago by Daniel3.5k
0
votes
0
answers
269
views
0
answers
Comment: C: Hypergeometric test ?
... Thanks May I Ask what OP means ? As far as i understand we have done DEG ,GO and other analysis so we want to find out Gene enrichment for disease associated genes in each class or group and see any biasness? ...
written 6 months ago by Azhar20
0
votes
1
answer
269
views
1
answers
Comment: C: sickle output explanation?
... Thanks Istvan Albert I understand that you said above i know offcourse we have to determine from fastqc report for trimming but my question is run the above mentioned command and there nothing happened for long time and then ihave to cntrl c . So my question is i dont know is it worked or not ? b ...
written 6 months ago by Azhar20
0
votes
0
answers
269
views
0
answers
Hypergeometric test ?
... I have a set of micro array data set and have total number of genes 23233 and subset of two classes like A and B after DEG so i want to anaylsis these for MGI Do disease data set by Hypergeometric test so what i take total number of genes =23233 class A like 1801 class B like 1417 so what i did i ...
rna-seq written 6 months ago by Azhar20 • updated 6 months ago by Devon Ryan74k
0
votes
1
answer
269
views
1
answer
sickle output explanation?
... Hi I used sickle to trimme the pair end sequence in fastqc format so i used this command sickle pe -f /pathtofile/inputfile1.fq -r /pathtofile/inputfile.fq2 -o /pathtofile/outputfile1 -p /pathtofile/outputfile2 -t sanger and the result is like this Total input FastQ records: 116382 ...
chip-seq written 6 months ago by Azhar20 • updated 6 months ago by Istvan Albert ♦♦ 75k
2
votes
1
answer
326
views
1
answer
Fastx tools no output?
... Hi I am trying to use Fastx tools but after running for long time even whole no out put on shell also no output after many ours no running is shown no error just blank screen I used fastx trimmer and quality filter. For fastq quality filter the code which i used is below fastq_quality_filter - ...
chip-seq written 6 months ago by Azhar20 • updated 6 months ago by glihm530

Latest awards to Azhar

Popular Question 4 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Centurion 6 months ago, created 100 posts.
Popular Question 9 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Popular Question 10 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Popular Question 20 months ago, created a question with more than 1,000 views. For How to visualize a bam file in UCSC Genome Browser
Popular Question 20 months ago, created a question with more than 1,000 views. For Bowtie 2 error

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1422 users visited in the last hour