User: manekineko

gravatar for manekineko
Last seen:
2 weeks, 1 day ago
5 years, 2 months ago

Posts by manekineko

<prev • 99 results • page 1 of 10 • next >
Comment: C: pathway or network from DEG list tool (plant)
... I agree, but I cannot find a way to intersect my accession numbers to let say with tomato or closer organism..... ...
written 15 days ago by manekineko130
Comment: C: pathway or network from DEG list tool (plant)
... Unfortunately, STRINGS do not have pepper as an organism afaik. ...
written 16 days ago by manekineko130
pathway or network from DEG list tool (plant)
... I have a list of DEG genes (e.g. T459_18598, from a plant in Ensembl), what tool I can use to see if there is a genes connected to each other forming a pathway or a network or connected by a function. The problem is that the plant (pepper) is not so popular among such tools and well-annotated? ...
pathway network deg written 16 days ago by manekineko130 • updated 16 days ago by Leite1.0k
Comment: C: Collapsing BAM based on seq and positions
... I just made an example some flags may be wrong, view it as mapped. I hope you got what I mean and want to do? ...
written 6 months ago by manekineko130
Comment: C: Collapsing BAM based on seq and positions
... For example, if containing identical seq mapping the same pos: HISEQ:47:C6FUWANXX:1:1101:1212:2073 4 contig1222 1 25 22M * 0 0 TATTGCACTTGTCCCGGCCTGT BBBBBFFFFFFFFFFFFFFFFF XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:21C0 HISEQ: ...
written 6 months ago by manekineko130
Comment: A: Collapsing BAM based on seq and positions
... I need something like FASTA collapsing, where you retain only 1 unique sequence with its copy number, but on a level of BAM file. I have BAM mapped with uncollapsed sequences, and need to collapsed it somehow to have BAM with unique sequences mapped somewhere and its copy number (retained in the nam ...
written 6 months ago by manekineko130
5 follow
Collapsing BAM based on seq and positions
... Is there a tool I can use to input a BAM and do a collapsing based on sequence and positions and retaining the copy number of the unique sequence? (outputing again BAM) ...
bam collapse written 6 months ago by manekineko130
Comment: A: Do you need a deduplication tool for FASTQ data in fastp?
... After 7 months how is the landscape? Is there a tool for extract UMIs and deduplication on FASTQ level? I have workflow and I need to have deduplication before mapping and BAM? ...
written 7 months ago by manekineko130
qiime open vs closed picking with SILVA?
... I have v3-v5 samples and want to run them to mothur and qiime to see the differences with SILVA. I'm not so familiar with qiime and want to ask if I use SILVA reference is there a difference in using closed or open picking OTU? ...
silva qiime written 12 months ago by manekineko130
Comment: C: Early Stage Researcher (with PhD option) - Bioinformatics (Marie-Curie Actions H
... Deadline is extended till 10 August. ...
written 2.1 years ago by manekineko130

Latest awards to manekineko

Popular Question 6 months ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 6 months ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 6 months ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 12 months ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.0 years ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.0 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.0 years ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 2.0 years ago, created a question with more than 1,000 views. For bowtie options for exact match with reference short sequence
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.6 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 2.6 years ago, created a question with more than 1,000 views. For bowtie options for exact match with reference short sequence
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Removing barcode and adapters?
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Problems with STAR mapping output
Popular Question 2.6 years ago, created a question with more than 1,000 views. For htseq-count counts all reads as no_feature
Popular Question 2.7 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.7 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.8 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.8 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 3.4 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 3.4 years ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 3.4 years ago, created a question with more than 1,000 views. For Removing barcode and adapters?
Student 3.4 years ago, asked a question with at least 3 up-votes. For Extending ends of sequences with the help of reads?
Popular Question 3.6 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1528 users visited in the last hour