User: manekineko

gravatar for manekineko
manekineko140
Reputation:
140
Status:
Trusted
Location:
Last seen:
3 months ago
Joined:
5 years, 5 months ago
Email:
v*****@plantgene.eu

Posts by manekineko

<prev • 99 results • page 1 of 10 • next >
0
votes
1
answer
154
views
1
answers
Comment: C: pathway or network from DEG list tool (plant)
... I agree, but I cannot find a way to intersect my accession numbers to let say with tomato or closer organism..... ...
written 3 months ago by manekineko140
0
votes
1
answer
154
views
1
answers
Comment: C: pathway or network from DEG list tool (plant)
... Unfortunately, STRINGS do not have pepper as an organism afaik. ...
written 3 months ago by manekineko140
0
votes
1
answer
154
views
1
answer
pathway or network from DEG list tool (plant)
... I have a list of DEG genes (e.g. T459_18598, from a plant in Ensembl), what tool I can use to see if there is a genes connected to each other forming a pathway or a network or connected by a function. The problem is that the plant (pepper) is not so popular among such tools and well-annotated? ...
pathway network deg written 3 months ago by manekineko140 • updated 3 months ago by Leite1.1k
0
votes
0
answers
250
views
0
answers
Comment: C: Collapsing BAM based on seq and positions
... I just made an example some flags may be wrong, view it as mapped. I hope you got what I mean and want to do? ...
written 8 months ago by manekineko140
0
votes
0
answers
250
views
0
answers
Comment: C: Collapsing BAM based on seq and positions
... For example, if containing identical seq mapping the same pos: HISEQ:47:C6FUWANXX:1:1101:1212:2073 4 contig1222 1 25 22M * 0 0 TATTGCACTTGTCCCGGCCTGT BBBBBFFFFFFFFFFFFFFFFF XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:21C0 HISEQ: ...
written 8 months ago by manekineko140
0
votes
0
answers
250
views
0
answers
Comment: A: Collapsing BAM based on seq and positions
... I need something like FASTA collapsing, where you retain only 1 unique sequence with its copy number, but on a level of BAM file. I have BAM mapped with uncollapsed sequences, and need to collapsed it somehow to have BAM with unique sequences mapped somewhere and its copy number (retained in the nam ...
written 8 months ago by manekineko140
2
votes
0
answers
250
views
5 follow
0
answers
Collapsing BAM based on seq and positions
... Is there a tool I can use to input a BAM and do a collapsing based on sequence and positions and retaining the copy number of the unique sequence? (outputing again BAM) ...
bam collapse written 8 months ago by manekineko140
0
votes
2
answers
1.3k
views
2
answers
Comment: A: Do you need a deduplication tool for FASTQ data in fastp?
... After 7 months how is the landscape? Is there a tool for extract UMIs and deduplication on FASTQ level? I have workflow and I need to have deduplication before mapping and BAM? ...
written 9 months ago by manekineko140
0
votes
0
answers
294
views
0
answers
qiime open vs closed picking with SILVA?
... I have v3-v5 samples and want to run them to mothur and qiime to see the differences with SILVA. I'm not so familiar with qiime and want to ask if I use SILVA reference is there a difference in using closed or open picking OTU? ...
silva qiime written 15 months ago by manekineko140
0
votes
0
answers
1.2k
views
0
answers
Comment: C: Early Stage Researcher (with PhD option) - Bioinformatics (Marie-Curie Actions H
... Deadline is extended till 10 August. ...
written 2.3 years ago by manekineko140

Latest awards to manekineko

Popular Question 8 months ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 8 months ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 8 months ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 14 months ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.2 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 2.2 years ago, created a question with more than 1,000 views. For bowtie options for exact match with reference short sequence
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Check is RNA-seq mapping (tophat) is performed ok (hg38)?
Popular Question 2.8 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 2.8 years ago, created a question with more than 1,000 views. For bowtie options for exact match with reference short sequence
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Removing barcode and adapters?
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Problems with STAR mapping output
Popular Question 2.8 years ago, created a question with more than 1,000 views. For htseq-count counts all reads as no_feature
Popular Question 2.9 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 2.9 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 3.0 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 3.0 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 3.7 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?
Popular Question 3.7 years ago, created a question with more than 1,000 views. For Deseq web-based (with GUI)
Popular Question 3.7 years ago, created a question with more than 1,000 views. For Removing barcode and adapters?
Student 3.7 years ago, asked a question with at least 3 up-votes. For Extending ends of sequences with the help of reads?
Popular Question 3.8 years ago, created a question with more than 1,000 views. For multiple paired-end files for one sample?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 661 users visited in the last hour