User: nicolas.dussex

New User
New Zealand
Last seen:
1 year, 1 month ago
5 years, 6 months ago

Posts by nicolas.dussex

<prev • 4 results • page 1 of 1 • next >
Answer: A: Variant Effect Predictor parameters for custom gff and fasta
... Hi R.Blues, Did you manage to fix your issue? I am trying to do the same but I am having issues creating the cache and I think that it is due to the fact that my annotation has gene, mRNA, CDSs but not exons. Cheers, Nic ...
written 2.5 years ago by nicolas.dussex30
replace headers in a fasta file
... Hi, I would like to replace the first filed my headers in my fasta file and concatenate it to the 2nd field (my gene ID), such a, I start with this: > maker-scaffold_0-snap-gene-0.23-mRNA-1 gene=maker-scaffold_0-snap-gene-0.23 ATGGTGAAGCTCGTGGCGTTCTCGCCGTTCCGCTCGGCGCAGAGCGCGCTGGAGAACATGAACGCCG ...
fasta header replace written 5.1 years ago by nicolas.dussex30 • updated 5.1 years ago by venu6.7k
Test of selection across whole genomes
... Hi, I have a question regarding test of selection in PAML using full genomes. My dataset contains multiple individuals (2 to 8) for the 6 different species (A to F). For the analysis, I have two species (A and B) that have their genome annotated. The idea is two run the analysis twice, first using ...
paml selection written 5.2 years ago by nicolas.dussex30 • updated 4.7 years ago by ragavishn20
Lositan freezing after starting the analysis
... Hi everyone,   I am trying to run Lositan for 2 populations with n=100 or so and 17,000 SNP loci. For some reason Lositan freezes at this stage: "First simulation pass to determine neutral set". Any idea why and how I could sort it out? I am running it on a Mac.   Cheers Nic ...
lositan written 5.5 years ago by nicolas.dussex30

Latest awards to nicolas.dussex

Popular Question 16 months ago, created a question with more than 1,000 views. For replace headers in a fasta file
Popular Question 2.3 years ago, created a question with more than 1,000 views. For replace headers in a fasta file
Popular Question 5.0 years ago, created a question with more than 1,000 views. For Test of selection across whole genomes


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1756 users visited in the last hour