User: silas008

gravatar for silas008
silas008120
Reputation:
120
Status:
Trusted
Location:
Brazil
Last seen:
12 hours ago
Joined:
5 years, 1 month ago
Email:
s*******@gmail.com

Posts by silas008

<prev • 70 results • page 1 of 7 • next >
1
vote
2
answers
367
views
2
answers
STAR error: EXITING because of FATAL ERROR in reads input: short read sequence line: 0
... Hey, guys. How are you doing?! I am analysing a RNAseq. First of all I am doing a pre processing of the reads using fastx toolkit. time fastq_quality_filter -v -q 20 -p 70 -Q33 -i sample.fastq -o sample_quality_filtered.fastq and time fastx_clipper -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -v ...
rna-seq written 4 months ago by silas008120 • updated 10 days ago by ruiyan_hou0
0
votes
2
answers
18k
views
2
answers
Comment: C: LogFC and LogCPM
... Not really. I am not using the logCPM that came out in the final table exactly because of that. I calculate the CPM separately. ...
written 5 months ago by silas008120
0
votes
0
answers
143
views
0
answers
Comment: C: How to caracterize single point mutation (or editing) in RNAseq?
... Thank you very much, man. ...
written 5 months ago by silas008120
1
vote
0
answers
143
views
0
answers
How to caracterize single point mutation (or editing) in RNAseq?
... Hello, guys. I found some single point mutation (or RNA editing, I don't know) in my RNAseq. I want to classify those alterations... I mean, I want to know every position where they happen and teh type of alteration. What is the best way to do that? Is it possible to use GATK (Broad Institute) to ...
rnaseq gatk written 5 months ago by silas008120
3
votes
3
answers
271
views
3
answers
Is there some good software to align/compare fasta sequences in my PC
... Hello, guys Do you know some software that I can use in my PC to compare two (or more) sequences? I want something similar to Blast but not so complex (for comparisons like Sanger sequencing. I have seen some that can also identify automatically regions like GFP or RFP. Unfortunately it is for MA ...
fasta comparison written 12 months ago by silas008120 • updated 12 months ago by brian.fristensky110
1
vote
2
answers
1.8k
views
2
answers
Comment: C: How to perform multiple comparisons using edgeR?
... Hey, Charles. I will send I massage to the edgeR support. This is a little bit confuse to me. Thank you very much again!!! ...
written 14 months ago by silas008120
1
vote
2
answers
1.8k
views
2
answers
Comment: C: How to perform multiple comparisons using edgeR?
... Thank you very much. I have used `glmFit() glmLRT()`. I think it is the best choice for my in this case. Let me ask you a simple question. I know the normalization in edegR follows different rules than a simple normalization. But I can not understand something like this: **edgeR output** ...
written 14 months ago by silas008120
0
votes
2
answers
1.8k
views
2
answers
Comment: C: How to perform multiple comparisons using edgeR?
... Excellent. Thank you very much. ...
written 14 months ago by silas008120
0
votes
2
answers
1.8k
views
2
answers
Comment: C: How to perform multiple comparisons using edgeR?
... Hello, AT point. Thank you for helping. What is the difference between using CONTRASTS followed by loop FOR and using different `glmQLFTest()` for each comparison (like group2 vs group1... group3 vs group2... etc)? Thanks again ...
written 14 months ago by silas008120
0
votes
2
answers
1.8k
views
2
answers
Comment: C: How to perform multiple comparisons using edgeR?
... Hello I think I will follow your first recommendation: `glmFit()` `glmLRT()`. edgeR support also suggest this one as a good option, not only for multiple comparisons but also for group2vsgroup1 comparisons. Since we will validate the best targets of the data by qPCR later, I think we can use it for ...
written 14 months ago by silas008120

Latest awards to silas008

Popular Question 5 months ago, created a question with more than 1,000 views. For GEO (NCBI) confusing data
Popular Question 6 months ago, created a question with more than 1,000 views. For GEO (NCBI) confusing data
Great Question 12 months ago, created a question with more than 5,000 views. For LogFC and LogCPM
Popular Question 12 months ago, created a question with more than 1,000 views. For GEO (NCBI) confusing data
Popular Question 12 months ago, created a question with more than 1,000 views. For Pipeline for miRNA expression analysis
Popular Question 12 months ago, created a question with more than 1,000 views. For Length of RNAseq reads
Popular Question 12 months ago, created a question with more than 1,000 views. For Kmer sequences in 5' RNAseq reads
Epic Question 18 months ago, created a question with more than 10,000 views. For LogFC and LogCPM
Popular Question 18 months ago, created a question with more than 1,000 views. For GEO (NCBI) confusing data
Popular Question 18 months ago, created a question with more than 1,000 views. For How to add the gene names on wormbase_genes BED file?
Student 18 months ago, asked a question with at least 3 up-votes. For LogFC and LogCPM
Popular Question 24 months ago, created a question with more than 1,000 views. For GEO (NCBI) confusing data
Popular Question 2.0 years ago, created a question with more than 1,000 views. For GFF3 to GTF
Great Question 2.0 years ago, created a question with more than 5,000 views. For LogFC and LogCPM
Supporter 2.0 years ago, voted at least 25 times.
Popular Question 3.2 years ago, created a question with more than 1,000 views. For GFF3 to GTF
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Problem with Fastqc quality control for miRNAseq data
Popular Question 3.2 years ago, created a question with more than 1,000 views. For I need to know how to trimming RNAseq of GEO dataset.
Popular Question 3.2 years ago, created a question with more than 1,000 views. For How to save a terminal output in a txt file?
Popular Question 3.9 years ago, created a question with more than 1,000 views. For GFF3 to GTF
Popular Question 3.9 years ago, created a question with more than 1,000 views. For Difference between UCSC and Ensembl genomes
Popular Question 3.9 years ago, created a question with more than 1,000 views. For Problem with trimming ilumina adapter

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1455 users visited in the last hour