User: fufuyou

gravatar for fufuyou
fufuyou90
Reputation:
90
Status:
Trusted
Location:
United States
Last seen:
1 month, 2 weeks ago
Joined:
2 years, 9 months ago
Email:
f******@gmail.com

Posts by fufuyou

<prev • 63 results • page 1 of 7 • next >
0
votes
2
answers
225
views
2
answers
Comment: C: Extraction sequence from other sequence
... Hello Lieven, Thanks, Fuyou ...
written 3 months ago by fufuyou90
0
votes
2
answers
225
views
2
answers
Comment: C: Extraction sequence from other sequence
... Yes. I have two files and all sequences in two files. Thanks, Fuyou ...
written 3 months ago by fufuyou90
0
votes
1
answer
217
views
1
answers
Comment: C: SGE job array for MaSuRCA pipeline
... OK. Thanks. I will do next time as what you said. Fuyou ...
written 3 months ago by fufuyou90
1
vote
1
answer
217
views
1
answer
SGE job array for MaSuRCA pipeline
... This is a sh file from MaSuRCA pipeline. I want to do this by SGE array job or single job submit to server since the pipeline will take long time in this step. I did not know how to set up $SGE_TASK_ID. Could you give me some suggestions? Thanks, Fuyou #!/bin/sh perl='/usr/bin/env per ...
assembly written 3 months ago by fufuyou90 • updated 3 months ago by h.mon15k
0
votes
2
answers
225
views
2
answers
Comment: C: Extraction sequence from other sequence
... Thanks. yes. I want to use seq2's sequence to replace the code in seq1. Fuyou ...
written 3 months ago by fufuyou90
0
votes
2
answers
225
views
2
answers
Comment: C: Extraction sequence from other sequence
... Thanks. Some sequence is long. ...
written 3 months ago by fufuyou90
2
votes
2
answers
225
views
2
answers
Extraction sequence from other sequence
... Hello, I have lots of sequences from two parts: one is >seqeunce1 ATGTGTGTTGTACAACTTTGGTATATACTGTATATACC42327477R_3222148F_10594369R_21575807R_1679947F_28391165R other is >42327477R_3222148F_10594369R_21575807R_1679947F_28391165R TGTGTTGTACAACTTTGGTATATACTGTATATACC I want ...
assembly written 3 months ago by fufuyou90 • updated 3 months ago by lieven.sterck1.4k
0
votes
3
answers
327
views
3
answers
Comment: C: compare two gene lists
... This is work well fast. ...
written 5 months ago by fufuyou90
0
votes
3
answers
327
views
3
answers
Comment: C: compare two gene lists
... This can not handle lots of data. I tried it. ...
written 5 months ago by fufuyou90
0
votes
3
answers
327
views
3
answers
Comment: C: compare two gene lists
... Thanks. It works well. But it is very slow. ...
written 5 months ago by fufuyou90

Latest awards to fufuyou

Popular Question 11 weeks ago, created a question with more than 1,000 views. For how split the paired-end reads to mutilble paired-end reads?
Popular Question 3 months ago, created a question with more than 1,000 views. For how split the paired-end reads to mutilble paired-end reads?
Popular Question 3 months ago, created a question with more than 1,000 views. For extract data from txt files
Popular Question 14 months ago, created a question with more than 1,000 views. For extract data from txt files
Popular Question 14 months ago, created a question with more than 1,000 views. For samtools error file
Popular Question 14 months ago, created a question with more than 1,000 views. For SSPACE assembling Genome!
Supporter 15 months ago, voted at least 25 times.
Popular Question 18 months ago, created a question with more than 1,000 views. For samtools error file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 755 users visited in the last hour