User: PSB

gravatar for PSB
PSB0
Reputation:
0
Status:
New User
Last seen:
2 years, 2 months ago
Joined:
5 years, 2 months ago
Email:
p**************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by PSB

<prev • 13 results • page 1 of 2 • next >
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Extract uniquely mapped reads from one species
... Hi goodez, Thank you for the answer and the code. I do have unique chromosome names for each genome, so the file looks like 7001289F:143:CBY2FANXX:1:1107:2105:1964 99 chr11 96938063 255 1S124M = 96938130 192 NGACCCAGGCTGAAGTGGGGGATCAACACAGGACAAGGTTGCCTCGGGAGG ...
written 2.4 years ago by PSB0
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Extract uniquely mapped reads from one species
... Hi, Thanks for your answer. That's an interesting approach and it'll be very helpful if you can provide explanation/code about how you did it. Many thanks. ...
written 2.4 years ago by PSB0
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Extract uniquely mapped reads from one species
... Many thanks genomax and Antonio, I've came across with this tool which I found very useful. However, my end goal is to see hoy many reads across samples are from mouse and how many are from plasmodium from the total number of reads. That being so (maybe I'm wrong) but I thought filtering the fastq ...
written 2.4 years ago by PSB0
5
votes
1
answer
1.5k
views
1
answer
Extract uniquely mapped reads from one species
... Hi, Using STAR and a reference fasta file with both the genomes of mouse and plasmodium I've mapped my fastq files (with reads from both mouse and plasmodium). I used a GFF annotation file too in the alignment. Now I have BAM files with reads mapped uniquely to mouse or plasmodium genome and multim ...
dual rna-seq host-pathogen rna-seq written 2.4 years ago by PSB0 • updated 2.4 years ago by goodez480
0
votes
1
answer
2.9k
views
1
answers
Comment: C: Aborted session in R using featureCounts in Rsubread
... Hi, I don't know if is the main reason but I notice in my case the problem was caused by the header of the BAM file. However, I didn't find the problematic line or tag. ...
written 4.9 years ago by PSB0
0
votes
1
answer
2.9k
views
1
answers
Comment: C: Aborted session in R using featureCounts in Rsubread
... Hi, using this code in both RStudio and R: conteototalnuevo = featureCounts(files=c("1077_C274.bam", "1078_C283.bam", "1079_C3_MAC-277.bam", "1080_M1-MA-269.bam", "1081_M2-MA-239.bam", "1082_M3-MA-305.bam", "1083_CM1-363.bam", "1084_CM2-369.bam", "1085_CM3-MAC-360.bam", "1086_MM1-MA-376.bam", " ...
written 5.0 years ago by PSB0 • updated 11 months ago by _r_am31k
0
votes
1
answer
2.9k
views
1
answers
Comment: C: Aborted session in R using featureCounts in Rsubread
... Hi, you mean post some screenshots of the files or copy paste them here or in my original post? The SAM file from one BAM file looks like: https://gist.github.com/RamRS/b66e5c4bdf99c42599074299ecf0bd3b The GTF file looks like: https://gist.github.com/RamRS/ea1123e682dc32d098753ef52a1c2c83 Hope ...
written 5.0 years ago by PSB0 • updated 11 months ago by _r_am31k
0
votes
1
answer
2.9k
views
1
answers
Comment: C: Aborted session in R using featureCounts in Rsubread
... Hi, I used the source package and it gives the same segfault error, both using my SAF file and using an unmodified GTF file from Emsembl. ...
written 5.0 years ago by PSB0 • updated 11 months ago by _r_am31k
0
votes
1
answer
2.9k
views
1
answers
Comment: C: Aborted session in R using featureCounts in Rsubread
... Hi, thanks for your reply. featureCounts comes from both [Rsubread, an R package]( https://bioconductor.org/packages/release/bioc/html/Rsubread.html) and from [Subread, an executable command-line package](http://subread.sourceforge.net/). I ignore what version (binary/source) Rsubread uses, but I ...
written 5.0 years ago by PSB0 • updated 11 months ago by _r_am31k
0
votes
1
answer
2.9k
views
1
answers
Comment: C: Aborted session in R using featureCounts in Rsubread
... Hi, thanks for your answer. Using awk I found I have the required 5 columns. The file is also tab-delimited. I tried some of the options of the link, None of them show any result. Nevertheless, I will explore this option. Apart from that, featureCounts fails at the very beginning of the analysis, ...
written 5.0 years ago by PSB0 • updated 11 months ago by _r_am31k

Latest awards to PSB

Popular Question 4.3 years ago, created a question with more than 1,000 views. For Aborted session in R using featureCounts in Rsubread

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 982 users visited in the last hour