User: manuel.belmadani

Reputation:
570
Status:
Trusted
Location:
Canada
Twitter:
pragmatwit
Scholar ID:
Google Scholar Page
Last seen:
2 days, 21 hours ago
Joined:
3 years, 6 months ago
Email:
m***************@gmail.com

Posts by manuel.belmadani

<prev • 76 results • page 1 of 8 • next >
0
votes
0
answers
67
views
0
answers
Comment: C: How can I do mass spectra in silico
... Would this take care of the simulation part? http://bioinfo.ict.ac.cn/OpenMS-Simulator/ This might be useful for assembly, https://github.com/warrenlr/PASS some of the outputs look similar to the example you provided (with some differences, e.g. using sequence name instead of peptide in the first ...
written 3 days ago by manuel.belmadani570
0
votes
0
answers
67
views
0
answers
Comment: C: How can I do mass spectra in silico
... By the way, `chainsaw` from Proteowizard might be useful for digestion: http://proteowizard.sourceforge.net/tools/chainsaw.html ...
written 3 days ago by manuel.belmadani570
1
vote
1
answer
140
views
1
answers
Comment: C: Is there any benefit in sorting a sam/bam file by coordinates vs. queryname?
... I think paired-end reads would be guaranteed to be adjacent in a sort-by-name, whereas it wouldn't necessarily be so with a coordinate sorted BAM. ...
written 6 days ago by manuel.belmadani570
0
votes
0
answers
105
views
0
answers
Comment: C: search multiple sequences in multiple fastqs
... cutadapt should get rid of reads > 30 in length in that case. Are you sure that you have the trimmed file in `my_files`, and not the original file you had before running cutadapt? ...
written 7 days ago by manuel.belmadani570
0
votes
0
answers
105
views
0
answers
Comment: C: search multiple sequences in multiple fastqs
... Make sure; do `awk '{print length}' | sort -n | tail` . The last number should be the longest sequence length in your file. Remove the headers before if you think they're longer than 30bp (i.e. `grep -v ">" | awk '{print length}' | sort -n | tail` ...
written 7 days ago by manuel.belmadani570
0
votes
0
answers
105
views
0
answers
Comment: C: search multiple sequences in multiple fastqs
... By the way, the `-f` switch in grep allows you to provide a file of patterns to search; e.g. `grep -f `, so possibly your could get rid of your inner for loop. ...
written 7 days ago by manuel.belmadani570
1
vote
6
answers
242
views
6
answers
Comment: C: How to create a tab delimited file?
... It's complaining about `or die "Can't read from $infile: $!";`. Which makes sense, if `open (my $infile, "<", "namconvmars.txt")` fails for some reason, then `$infile` wont be set, so you can't use it in your error message (which would print the content of the file anyways, probably not what you ...
written 11 days ago by manuel.belmadani570
0
votes
2
answers
107
views
2
answers
Comment: C: Simple FASTQ/A manipulation... how to add a single adapter sequence to 5' of all
... I added the `>` in the character class. Just be careful that your FASTA files don't have reads over multiple lines, or it'll break (and add AAAAAA at each non-header begining of line, even if multiple lines are part of the same contiguous reads.) This use case is a bit more complicated than the p ...
written 11 days ago by manuel.belmadani570
3
votes
2
answers
107
views
2
answers
Answer: A: Simple FASTQ/A manipulation... how to add a single adapter sequence to 3' of all
... `sed` will do that: $ sed 's|^[^@>]\(.*\)|AAAAAA\1|g' fastq.fq @header AAAAAATCTCAGATCGGAAGAGCACACGT @header AAAAAACGGTCCTGGTTGCAGATCGGAAG @header AAAAAATATCTCCTAAGATATAACAGGTTG @header AAAAAAGGTACAGGTTGGATGATAAGTCC $ sed 's|^[^@>]\(.*\)|AAAAAA\1|g' f ...
written 12 days ago by manuel.belmadani570
2
votes
6
answers
242
views
6
answers
Answer: A: How to create a tab delimited file?
... You want to split your input on space, not tab. e.g. # my @cols = split(/\t/); # Change this my @cols = split(' '); # To this. ...
written 12 days ago by manuel.belmadani570

Latest awards to manuel.belmadani

Scholar 12 days ago, created an answer that has been accepted. For A: wonderdump.sh and FTP site URL conventions for SRR identifiers
Teacher 12 days ago, created an answer with at least 3 up-votes. For A: NGS analysis: how to handle paired-end reads
Good Answer 6 weeks ago, created an answer that was upvoted at least 5 times. For A: Reproducing this plot in R
Appreciated 6 weeks ago, created a post with more than 5 votes. For A: Reproducing this plot in R
Scholar 6 weeks ago, created an answer that has been accepted. For A: wonderdump.sh and FTP site URL conventions for SRR identifiers
Teacher 6 weeks ago, created an answer with at least 3 up-votes. For A: NGS analysis: how to handle paired-end reads
Supporter 7 weeks ago, voted at least 25 times.
Teacher 7 weeks ago, created an answer with at least 3 up-votes. For A: NGS analysis: how to handle paired-end reads
Scholar 7 weeks ago, created an answer that has been accepted. For A: wonderdump.sh and FTP site URL conventions for SRR identifiers
Teacher 7 weeks ago, created an answer with at least 3 up-votes. For A: NGS analysis: how to handle paired-end reads
Scholar 7 weeks ago, created an answer that has been accepted. For A: wonderdump.sh and FTP site URL conventions for SRR identifiers
Teacher 7 weeks ago, created an answer with at least 3 up-votes. For A: NGS analysis: how to handle paired-end reads
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: NGS analysis: how to handle paired-end reads
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: NGS analysis: how to handle paired-end reads
Scholar 8 months ago, created an answer that has been accepted. For A: wonderdump.sh and FTP site URL conventions for SRR identifiers
Scholar 9 months ago, created an answer that has been accepted. For A: wonderdump.sh and FTP site URL conventions for SRR identifiers

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1985 users visited in the last hour