User: auryndb

gravatar for auryndb
auryndb60
Reputation:
60
Status:
Trusted
Location:
Canada
Last seen:
3 years, 5 months ago
Joined:
3 years, 10 months ago
Email:
m*******@mail.utoronto.ca

Posts by auryndb

<prev • 17 results • page 1 of 2 • next >
0
votes
1
answer
970
views
1
answers
Comment: C: How to see if a gene is expressed in mouse undifferentiated embryonic stem cell?
... I did that. But how can I know if my gene is there or not? http://genome.ucsc.edu/cgi-bin/hgTracks?db=mm9&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr11%3A77851443%2D77873934&hgsid=481968789_9OTOvrJx9kSJKl ...
written 3.4 years ago by auryndb60
5
votes
1
answer
970
views
1
answer
How to see if a gene is expressed in mouse undifferentiated embryonic stem cell?
... How can I see if my gene is expressed in mouse ESC using available RNA-seq data? IS there any website that I can simply put the name of my gene down and get a results if it is expressed or not. ( I know about ENCODE, or ESCAPE) but I have not been able to find how to do this in their websites. ...
rna-seq written 3.4 years ago by auryndb60 • updated 3.4 years ago by jotan1.2k
0
votes
0
answers
1.1k
views
0
answers
How to read a DNA sequence for Motif analysis more efficiently?
... I wrote a code in python to read DNA sequences and do a motif alignment on them but I'm looking for a more efficient way to do this. See below if you can help: handle = open("a.fas.txt", "r") a = handle.readlines()[1:] a = ''.join([x.strip() for x in a]) with open("Output.txt", "w") ...
python written 3.5 years ago by auryndb60
0
votes
3
answers
4.5k
views
3
answers
Comment: C: Searching for a sequence string in python?
... okay imagine the fasta sequence like (fasta sequences are divided in lines): atatatacggcgcgagaatatctctc**atata** **atat**ctctctatattatagccctctctctctctaa with my code, it can't find the sequence if it's at the end of the first line and at the beginning of the second line. ...
written 3.5 years ago by auryndb60
7
votes
3
answers
4.5k
views
3
answers
Searching for a sequence string in python?
... Hey all, So I'm using plain python (I'm not using BioPython) to search for a string in E. Coli genome. How I do it is that I read each line of a fasta sequence, and I'll do an if sequence return thing on it, a pseudocode like this: ecoli_sequence = open('ecolik12.fasta', 'r') a = ecoli_se ...
genome python written 3.5 years ago by auryndb60 • updated 3.5 years ago by John12k
0
votes
2
answers
1.2k
views
2
answers
Browsing E.Coli K-12 strain in a genome browser?
... Hey all, So I want to browse the genome of e. coli strain K-12, just like when I can browse a human genome or a mouse genome. There are many places on the web that you can download the genome, but there is actually no simple instruction on how to browse the genome. Can you kindly provide a link? Th ...
genome written 3.5 years ago by auryndb60 • updated 3.5 years ago by genomax70k
0
votes
0
answers
80
views
0
answers
Comment: C: Convolution in motif detection
... page 15: www.cs.ubc.ca/~murphyk/Papers/seqcmp.ps.gz ...
written 3.5 years ago by auryndb60
0
votes
0
answers
797
views
0
answers
Comment: C: How to get access to dreamchallenges.org source codes submitted by different tea
... It's corrected, thanks ...
written 3.5 years ago by auryndb60 • updated 11 months ago by RamRS23k
0
votes
0
answers
797
views
0
answers
How to get access to dreamchallenges.org source codes submitted by different teams for closed dreams?
... Is it possible to gain access to the source code of files submitted to closed dreams from dreamchallenges.org of different teams? I am specially interested in dream challenges DREAM5, identification of TF binding sites. I can download the database for closed challenges, but there is no link for team ...
k-mer dreamchallenge.org written 3.5 years ago by auryndb60
3
votes
2
answers
2.0k
views
2
answers
Answer: A: Advice for someone considering bioinformatics?
... Take a look at [this][1] [1]: https://www.biostars.org/p/170714/ ...
written 3.5 years ago by auryndb60 • updated 11 months ago by RamRS23k

Latest awards to auryndb

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 746 users visited in the last hour