User: kritika1424

gravatar for kritika1424
kritika142470
Reputation:
70
Status:
Trusted
Location:
India
Last seen:
3 days, 1 hour ago
Joined:
1 year, 4 months ago
Email:
k************@gmail.com

Posts by kritika1424

<prev • 74 results • page 1 of 8 • next >
0
votes
1
answer
112
views
1
answer
how to know chromosome segments from the list of genes
... Hello All I have list of genes i want to know which all genes will make one chromosome segments So For example i have gene A , B , C , D i want for example A,B, C forming one stretch of chromosome segment (1p15.1p20) 1p15.1p.20 will make one segment. If i have ramdom gene name i want which genes w ...
chromosome segments gene mapping written 3 days ago by kritika142470 • updated 3 days ago by Devon Ryan68k
0
votes
0
answers
83
views
0
answers
Comment: C: which indel to consider
... FHVOG:07330:07541 0 chr1 14724 2 37M1I25M1I4M1I56M1I9M1I17M1I37M1I8M * 0 0 CCTGCCTGTGGCTGCTGCGGTGGCGGCAGAGGAGGGATTGGAGTCTGACACGCGGGCAAAGGCTTCCTCCCGGGCCCCTCACCAGCCCCAGGCCCTTTCCCAGAGATGCCTGGAGGGAAAAGGCTCGAGTGAGGGTTGGTTGGTGGGAAACCCTTGGTTCCCCCAGCCCCCGGAGACTTA ...
written 8 days ago by kritika142470
0
votes
0
answers
83
views
0
answers
which indel to consider
... Hi All, First of all sorry if this question is silly or already answered please bear I have bam file FHVOG:09133:14031 0 chr1 14716 4 201M * 0 0 CGTCCTCCTCTGCCTGTGGCTGCTGCGGTGGCGGCAGAGGAGGGATGGAGTCTGA FHVOG:09370:07492 0 chr1 1471 ...
exome mapping quality indel calls cigar value written 9 days ago by kritika142470 • updated 9 days ago by Pierre Lindenbaum94k
0
votes
3
answers
154
views
3
answers
Comment: C: heatmap using DESeq2
... Follow this https://cran.rstudio.com/web/packages/pheatmap/pheatmap.pdf ...
written 22 days ago by kritika142470
0
votes
3
answers
154
views
3
answers
Answer: C: heatmap using DESeq2
... You can extract FPKM values or Count value (If you are using htseq-count) of top differentially expressed gene. by this FPKM matrix you can plot heatmap using pheatmap library or heatmap.2(ggplot lib). ...
written 22 days ago by kritika142470
0
votes
0
answers
86
views
0
answers
Exome seq analysis for Ion S5 sample
... Hello All Recently I got some new project from Ion S5 sample (human sample) I want to try open source software with this data (starting from QC to Annotation) I dont want to use Tmap or Torretsuite So can any only help me knowing tools like FASTQC , GATK and samtools which can be used for Ion S5 s ...
exome ion s5 data analysis written 26 days ago by kritika142470
1
vote
0
answers
140
views
0
answers
Transcritome analysis using ion torrent sample
... Hi all I am new for RNASeq analysis using ion torrent What I want to know is what is file format for ion torrent machine And can I use tophat cufflink nd cuffdiff for my ion torrent samples for transcritome analysis ...
ion torrent rnaseq protocol written 9 weeks ago by kritika142470
0
votes
0
answers
175
views
0
answers
Comment: C: duplicate gene ids after running toxedo protocol
... They are not isoforms ...
written 4 months ago by kritika142470
0
votes
0
answers
175
views
0
answers
duplicate gene ids after running toxedo protocol
... Hello All I am runnig tuxedo protocol for my human samples after running the cufflink i am getting the duplicate value of gene id and with different fpkms for example **gene id fpkm_control1 fpkm_control2 fpkm_test1 fpkm_test2** **abc 0.88 0.65 0.56 0.1** **abc ...
duplicate gene id human sample rna-seq written 4 months ago by kritika142470 • updated 3 months ago by Biostar ♦♦ 20
0
votes
0
answers
266
views
0
answers
Comment: C: differential expression of human sample showing 63000 genes in output
... But this time i used ref and gtf of hg19 For both the version initially i was getting 63000 genes. This time i only filtered protien coding genes in hg19.gtf and used that i got 27000 genes for all samples. Not sure whether i am correct or not ...
written 5 months ago by kritika142470

Latest awards to kritika1424

Popular Question 6 months ago, created a question with more than 1,000 views. For SAM line does not contain at least 11 tab-delimited fields
Popular Question 10 months ago, created a question with more than 1,000 views. For to run bowtie on multiple fastq file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1226 users visited in the last hour