User: kritika1424

gravatar for kritika1424
kritika142470
Reputation:
70
Status:
Trusted
Location:
India
Last seen:
2 weeks ago
Joined:
1 year, 8 months ago
Email:
k************@gmail.com

Posts by kritika1424

<prev • 76 results • page 1 of 8 • next >
0
votes
0
answers
102
views
0
answers
SNP analysis of Allotetraploid genome
... Hi All Recently i got whole genome seq data of allotetraploid genome(Plant) generated from illumina the basic pipleine which i am following is 1)Fastqc (Quality check) 2)Trimming if required 3)Mapping against reference 4)Snp Call using GATK or Samtools 5)Snp prirotization using SnpEff My query is ...
illumina snp analysis whole genome sequence written 14 days ago by kritika142470
0
votes
1
answer
161
views
1
answer
how to get name column having more number of gene occurrence
... Hello All i have file for example like this: s1 s2 s3 s4 s5 s6 x y a q a h h b a h a q a c v b n k b c a assuming a,b,c,d,e,f is my genes name so as can be seen x is only present in one sample so i can say x is present in 16.6% population only ...
gene occurence column written 3 months ago by kritika142470 • updated 3 months ago by Chirag Parsania430
0
votes
1
answer
201
views
1
answer
how to know chromosome segments from the list of genes
... Hello All I have list of genes i want to know which all genes will make one chromosome segments So For example i have gene A , B , C , D i want for example A,B, C forming one stretch of chromosome segment (1p15.1p20) 1p15.1p.20 will make one segment. If i have ramdom gene name i want which genes w ...
chromosome segments gene mapping written 4 months ago by kritika142470 • updated 4 months ago by Devon Ryan71k
0
votes
0
answers
152
views
0
answers
Comment: C: which indel to consider
... FHVOG:07330:07541 0 chr1 14724 2 37M1I25M1I4M1I56M1I9M1I17M1I37M1I8M * 0 0 CCTGCCTGTGGCTGCTGCGGTGGCGGCAGAGGAGGGATTGGAGTCTGACACGCGGGCAAAGGCTTCCTCCCGGGCCCCTCACCAGCCCCAGGCCCTTTCCCAGAGATGCCTGGAGGGAAAAGGCTCGAGTGAGGGTTGGTTGGTGGGAAACCCTTGGTTCCCCCAGCCCCCGGAGACTTA ...
written 4 months ago by kritika142470
0
votes
0
answers
152
views
0
answers
which indel to consider
... Hi All, First of all sorry if this question is silly or already answered please bear I have bam file FHVOG:09133:14031 0 chr1 14716 4 201M * 0 0 CGTCCTCCTCTGCCTGTGGCTGCTGCGGTGGCGGCAGAGGAGGGATGGAGTCTGA FHVOG:09370:07492 0 chr1 1471 ...
exome mapping quality indel calls cigar value written 4 months ago by kritika142470 • updated 4 months ago by Pierre Lindenbaum99k
0
votes
3
answers
394
views
3
answers
Comment: C: heatmap using DESeq2
... Follow this https://cran.rstudio.com/web/packages/pheatmap/pheatmap.pdf ...
written 4 months ago by kritika142470
0
votes
3
answers
394
views
3
answers
Answer: C: heatmap using DESeq2
... You can extract FPKM values or Count value (If you are using htseq-count) of top differentially expressed gene. by this FPKM matrix you can plot heatmap using pheatmap library or heatmap.2(ggplot lib). ...
written 4 months ago by kritika142470
0
votes
0
answers
173
views
0
answers
Exome seq analysis for Ion S5 sample
... Hello All Recently I got some new project from Ion S5 sample (human sample) I want to try open source software with this data (starting from QC to Annotation) I dont want to use Tmap or Torretsuite So can any only help me knowing tools like FASTQC , GATK and samtools which can be used for Ion S5 s ...
exome ion s5 data analysis written 4 months ago by kritika142470
1
vote
0
answers
225
views
0
answers
Transcritome analysis using ion torrent sample
... Hi all I am new for RNASeq analysis using ion torrent What I want to know is what is file format for ion torrent machine And can I use tophat cufflink nd cuffdiff for my ion torrent samples for transcritome analysis ...
ion torrent rnaseq protocol written 6 months ago by kritika142470
0
votes
0
answers
237
views
0
answers
Comment: C: duplicate gene ids after running toxedo protocol
... They are not isoforms ...
written 8 months ago by kritika142470

Latest awards to kritika1424

Popular Question 3 months ago, created a question with more than 1,000 views. For SAM line does not contain at least 11 tab-delimited fields
Popular Question 10 months ago, created a question with more than 1,000 views. For SAM line does not contain at least 11 tab-delimited fields
Popular Question 14 months ago, created a question with more than 1,000 views. For to run bowtie on multiple fastq file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1463 users visited in the last hour