User: infenit101

gravatar for infenit101
infenit10110
Reputation:
10
Status:
New User
Location:
Last seen:
2 days, 17 hours ago
Joined:
2 years, 9 months ago
Email:
i*********@gmail.com

Posts by infenit101

<prev • 17 results • page 1 of 2 • next >
0
votes
0
answers
71
views
0
answers
Bulk quality interleaving with bbmap reformat command
... I have several fastq.gz files that look like this: Sample1_R1.fastq.gz Sample1_R2.fastq.gz Sample2_R1.fastq.gz Sample2_R2.fastq.gz etc... The output needs to be: Sample1_interleaved.fastq.gz, Sample2_interleaved.fastq.gz I am still learning how to loop commands so bare with me. This is what I t ...
reformat loop bbduk bbmap bash written 3 days ago by infenit10110
0
votes
1
answer
790
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... I appreciate your advice. I'm actually in the process of learning python, but this would be a nice tool to learn relatively quickly. How long do you think this would take on a fasta file containing say 100,000 sequences? ...
written 21 months ago by infenit10110
0
votes
1
answer
790
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... I apologize Brian. I'll make sure I do that next time! ...
written 21 months ago by infenit10110
0
votes
1
answer
790
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... These are HiSeq paired end reads. They won't be any bigger than 150bp. Everything is <=150bp. ...
written 21 months ago by infenit10110
0
votes
1
answer
790
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... I am trying to use a script called REAGO to find 16S fragments from metagenomic data and it requires the length of all sequences to be the same for paired end reads. Most of my sequencing distribution is skewed between 100 to 150 bp. But very few read pairs after adapter trimming are 150 bp...usuall ...
written 21 months ago by infenit10110
0
votes
1
answer
790
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... >J00138:90:HG7YJBBXX:5:1101:19593:1719_2 CTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCTGTATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTATTCTGTCGGTAACGTCAAAACACTAACGTATTAGGTTAATGCCCTTCCTCCCA >J00138:90:HG7YJBBXX:5:1101:20334:2299_1 TAAGGCGAAGGCTTCTTTCTAACTAAACACTGACGCTGAGGTACGAAAGTATGGGGAGCAAAA ...
written 21 months ago by infenit10110
0
votes
6
answers
3.4k
views
6
answers
Answer: A: Parse Fastq File - Pad Reads With N'S
... Can this be done with fasta files? ...
written 21 months ago by infenit10110
7
votes
1
answer
790
views
1
answer
What is the fastest way to add 'Ns' to variable length sequences in a .fasta such that they have the same length
... Say I have a fasta containing 3 sequences... >J00138:90:HG7YJBBXX:5:1101:19593:1719_2 CTTTACGCCCAGTAAT >J00138:90:HG7YJBBXX:5:1101:20334:2299_1 TAAGGCGAAGGCTTCTTTC >J00138:90:HG7YJBBXX:5:1101:20334:2299_2 GCTTTAATCTACATTTATAGACTGATTAATAACC >J00138:90:HG7YJBBX ...
fasta python biopython sequencing written 21 months ago by infenit10110 • updated 21 months ago by Petr Ponomarenko2.5k
0
votes
2
answers
4.9k
views
2
answers
Answer: A: join non-overlapping paired-end reads
... Were you able to determine a good method for doing this? I am also interesting in merging non-overlapping reads which are from a friend's sequencing run in which they used primers targeting a 643 bp fragment which unfortunately is slightly too large to produce an overlap during a MiSeq run. ...
written 2.8 years ago by infenit10110
0
votes
2
answers
1.6k
views
2
answers
Comment: C: Help extracting the taxonomy for a file containing a list of accession numbers f
... Istvan thank you so much. I think its really time I learned how to script. Could you recommend a guide? ...
written 2.8 years ago by infenit10110

Latest awards to infenit101


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1852 users visited in the last hour