User: infenit101

gravatar for infenit101
infenit10120
Reputation:
20
Status:
New User
Location:
Last seen:
1 month, 2 weeks ago
Joined:
3 years, 4 months ago
Email:
i*********@gmail.com

Posts by infenit101

<prev • 20 results • page 1 of 2 • next >
0
votes
2
answers
169
views
2
answers
Comment: C: Question: How to run several one-way ANOVAs in R using on different categories?
... Thanks so much! Yes that was a typo. Can I use the same subsetted dataframe for TukeyHSD? ...
written 6 weeks ago by infenit10120
4
votes
2
answers
169
views
2
answers
How to run several one-way ANOVAs in R using on different categories?
... Thanks for reading my post. I understand how to run non-parametric and parametric tests on three or more groups. But what I haven't figured out was a simple way of doing this multiple times from different categories I am interested in. In my dataset, I have gene copies for various antibiotic classes ...
gene R statistics anova written 6 weeks ago by infenit10120 • updated 6 weeks ago by zx87547.8k
0
votes
3
answers
2.5k
views
3
answers
Comment: C: Relative abundance fro metagenomics samples
... Did you ever figure this out David? I am actually trying to do the same thing. ...
written 6 months ago by infenit10120
1
vote
1
answer
330
views
1
answer
Bulk quality interleaving with bbmap reformat command
... I have several fastq.gz files that look like this: Sample1_R1.fastq.gz Sample1_R2.fastq.gz Sample2_R1.fastq.gz Sample2_R2.fastq.gz etc... The output needs to be: Sample1_interleaved.fastq.gz, Sample2_interleaved.fastq.gz I am still learning how to loop commands so bare with me. This is what I t ...
reformat loop bbduk bbmap bash written 7 months ago by infenit10120 • updated 5 months ago by ross_whetten10
0
votes
1
answer
990
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... I appreciate your advice. I'm actually in the process of learning python, but this would be a nice tool to learn relatively quickly. How long do you think this would take on a fasta file containing say 100,000 sequences? ...
written 2.4 years ago by infenit10120
0
votes
1
answer
990
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... I apologize Brian. I'll make sure I do that next time! ...
written 2.4 years ago by infenit10120
0
votes
1
answer
990
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... These are HiSeq paired end reads. They won't be any bigger than 150bp. Everything is <=150bp. ...
written 2.4 years ago by infenit10120
0
votes
1
answer
990
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... I am trying to use a script called REAGO to find 16S fragments from metagenomic data and it requires the length of all sequences to be the same for paired end reads. Most of my sequencing distribution is skewed between 100 to 150 bp. But very few read pairs after adapter trimming are 150 bp...usuall ...
written 2.4 years ago by infenit10120
0
votes
1
answer
990
views
1
answers
Comment: C: What is the fastest way to add 'Ns' to variable length sequences in a .fasta suc
... >J00138:90:HG7YJBBXX:5:1101:19593:1719_2 CTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCTGTATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTATTCTGTCGGTAACGTCAAAACACTAACGTATTAGGTTAATGCCCTTCCTCCCA >J00138:90:HG7YJBBXX:5:1101:20334:2299_1 TAAGGCGAAGGCTTCTTTCTAACTAAACACTGACGCTGAGGTACGAAAGTATGGGGAGCAAAA ...
written 2.4 years ago by infenit10120
0
votes
6
answers
3.7k
views
6
answers
Answer: A: Parse Fastq File - Pad Reads With N'S
... Can this be done with fasta files? ...
written 2.4 years ago by infenit10120

Latest awards to infenit101


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1603 users visited in the last hour