User: Dhillonv10

gravatar for Dhillonv10
Dhillonv10100
Reputation:
100
Status:
New User
Location:
Last seen:
6 years, 5 months ago
Joined:
8 years, 7 months ago
Email:
d*********@gmail.com

Posts by Dhillonv10

<prev • 13 results • page 2 of 2 • next >
0
votes
2
answers
5.8k
views
2
answers
Comment: C: Most Frequent Nucleotide/String Pattern In Dna Sequence Files Using Python Or Bi
... Thanks @brentp, I have the same problem with this snippet as the one above it, I get this: Counter({Seq('CCTGTG', SingleLetterAlphabet()): 1, Seq('TCTGTG', SingleLetterAlphabet()): 1, Seq('TGGTGG', SingleLetterAlphabet()): 1, Seq('TTTCAG', SingleLetterAlphabet()): 1, Seq('TTTTGG', SingleLetter ...
written 8.3 years ago by Dhillonv10100 • updated 6 months ago by RamRS26k
0
votes
2
answers
5.8k
views
2
answers
Comment: C: Most Frequent Nucleotide/String Pattern In Dna Sequence Files Using Python Or Bi
... thanks @DK, I've tried somerhing like that, but here's the problem using COunter on the seq object gives me something like: Counter({Seq('CCTGTG', SingleLetterAlphabet()): 1, Seq('TCTGTG', SingleLetterAlphabet()): 1, Seq('TGGTGG', SingleLetterAlphabet()): 1, Seq('TTTCAG', SingleLetterAlphabet( ...
written 8.3 years ago by Dhillonv10100 • updated 6 months ago by RamRS26k
5
votes
2
answers
5.8k
views
2
answers
Most Frequent Nucleotide/String Pattern In Dna Sequence Files Using Python Or Biopython
... Hi all, So I'm working on this problem of finding the most frequent 6-nucleotide long patterns from a given DNA file which is a standard FASTA file looking like: >name of protein ACGTACTAGACAGAGAGAGAG .... <more nucleotides> >name of protein ACGTACTAGACAGAGAGAGAG .... <more nucle ...
fasta python biopython written 8.3 years ago by Dhillonv10100 • updated 8.3 years ago by brentp23k

Latest awards to Dhillonv10

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1082 users visited in the last hour