User: Paul

gravatar for Paul
Paul50
Reputation:
50
Status:
Trusted
Location:
India
Last seen:
53 minutes ago
Joined:
6 years, 9 months ago
Email:
p***************@gmail.com

Posts by Paul

<prev • 52 results • page 1 of 6 • next >
0
votes
0
answers
177
views
0
answers
Comment: C: Aligning Ion torrent sequenced genome with a reference sequence
... Thanks this is helpful... ...
written 7 weeks ago by Paul50
0
votes
0
answers
177
views
0
answers
Comment: C: Aligning Ion torrent sequenced genome with a reference sequence
... Yes, but I am not sure if the data is paired end. But if its a normal ion torrent sequence, how do i use bowtie2 to map it with my reference genome? ...
written 7 weeks ago by Paul50
0
votes
0
answers
177
views
0
answers
Comment: C: Aligning Ion torrent sequenced genome with a reference sequence
... This is bacterial_genome.fastq @3NPEK:00664:05761 GGACACCATGTCCTCCACGCCGTCCGCCGACGAAGGCTCGCCCAGCAACCTGATGCTGCGCGGCCGGCTCATCGACGCGTTGCGCTCCGACGTCATCCGCGGCCGGTACCCACCCGGGTACCGGCTGGTGGAGCGGGATGTGGCTGGACGCTTACGGGGTTCACGGCTCCCGGCACGCGAGGCCCTGCAGGCGCTGAAGACCGAGGGCTTTCTCGAGGTGCGCAAAACCCGTGGCCTGGT ...
written 7 weeks ago by Paul50
0
votes
0
answers
177
views
0
answers
Comment: C: Aligning Ion torrent sequenced genome with a reference sequence
... @Bastein, I have updated the post now, to make it more clear, Do i need specific ion torrent mapper to map this genome? ...
written 7 weeks ago by Paul50
0
votes
0
answers
177
views
0
answers
Comment: C: Aligning Ion torrent sequenced genome with a reference sequence
... To generate index i used, **bowtie2-build genome.fasta genome_index**. Yes, I think its a mate pair sequencing data. ...
written 7 weeks ago by Paul50
3
votes
0
answers
177
views
0
answers
Aligning Ion torrent sequenced genome with a reference sequence
... I am trying to align a bacterial genome with a reference genome using bowtie2 in ubuntu OS. The bacterial genome is sequenced using Ion torrent. The paired-end sequenced data of the bacterial genome is in fastq format in a single file (bacterial_genome.fastq). And the commands I used to align the ...
ngs snp bowtie sequencing written 7 weeks ago by Paul50
1
vote
0
answers
96
views
0
answers
SRA tootkit to download pileup formats using SRR accessions
... Is there a way I could directly download pileup format using SRR accession number ? I have list of SRR accesion IDs for which I directly want the pileup format. I have downloaded SRA-toolkit to use SRA-pileup tool, but not sure of getting a pileup format using SRR ID. Please suggest.. ...
sratoolkit next-gen pileup sequencing written 9 weeks ago by Paul50
0
votes
0
answers
463
views
0
answers
Comment: C: Mapping multiple reads to a single genome
... oh! can I generate a single bam file for all the subfolders? will that be fine? In that case, I can put all the SRR files in a single folder and map it against a single reference sequence. But I have thousands of SRR files ...
written 10 months ago by Paul50
0
votes
0
answers
463
views
0
answers
Mapping multiple reads to a single genome
... I have a number of pair-end and single-end reads to map it to a reference genome. TaxonID SRR files 1448592 SRR1172918 SRR1175065 SRR1184297 SRR1196515 1448462 SRR1180190 SRR1181352 SRR1181404 SRR1183042 1402586 SRR1011524 SRR1019194 1448524 SRR1172749 SRR1173120 SRR1184340 ...
bash written 10 months ago by Paul50 • updated 10 months ago by PoGibas4.7k
0
votes
0
answers
1.3k
views
0
answers
Comment: C: Is there a way to download FASTq files from SRR IDs?
... Thank you @genomax EBI-ENA. worked well in my case :) ...
written 10 months ago by Paul50

Latest awards to Paul

Popular Question 7 weeks ago, created a question with more than 1,000 views. For how to draw a decision tree?
Popular Question 7 weeks ago, created a question with more than 1,000 views. For Mapping HGNC ID to uniprot ID
Popular Question 7 weeks ago, created a question with more than 1,000 views. For Mapping HGNC ID to uniprot ID
Popular Question 6 months ago, created a question with more than 1,000 views. For How To Find Out The Transcripts?
Popular Question 6 months ago, created a question with more than 1,000 views. For How to sort all the columns all together of a dataframe using R?
Popular Question 6 months ago, created a question with more than 1,000 views. For How to assemble contigs?
Popular Question 10 months ago, created a question with more than 1,000 views. For Mapping HGNC ID to uniprot ID
Scholar 10 months ago, created an answer that has been accepted. For A: Retrieving SRA files using Taxonomic IDs
Supporter 13 months ago, voted at least 25 times.
Popular Question 23 months ago, created a question with more than 1,000 views. For Mapping HGNC ID to uniprot ID

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1691 users visited in the last hour