User: whaiyu06

gravatar for whaiyu06
New User
Last seen:
6 months, 1 week ago
2 years, 3 months ago

Posts by whaiyu06

<prev • 15 results • page 1 of 2 • next >
Comment: C: GATK IndelRealigner make mistakes
... I solved this issue by adding another parameter -filterNoBases. Thanks for your advice. ...
written 6 months ago by whaiyu0620
Comment: C: GATK IndelRealigner make mistakes
... Thanks.There nothing output as your command. ...
written 7 months ago by whaiyu0620
GATK IndelRealigner make mistakes
... hello, I used the command to realignment around indels.The command as follows: java -jar /Software/GenomeAnalysisTK-3.6/GenomeAnalysisTK.jar \ -R $ref \ -T IndelRealigner \ -targetIntervals A01-2m-B8_merge.mark.intervals \ -I A01-2m-B8_merge.mark.bam \ -o A01-2m-B8_merge ...
alignment sequencing written 7 months ago by whaiyu0620 • updated 7 months ago by Pierre Lindenbaum112k
5 follow
Picard MarkDuplicates /SAM validation error
... Hello,everyone I used Picardtools/MarkDuplicates as following: java -jar picard.jar \ INPUT=A01-2m-D6.sort.bam \ OUTPUT=A01-2m-D6.bam \ METRICS_FILE=A01-2m-D6.metrics CREATE_INDEX=true 2>A01-2m-D6.picard_MarkDuplicates.stderr then I met thus error: picard.sam.mar ...
alignment sequencing written 7 months ago by whaiyu0620 • updated 7 months ago by Pierre Lindenbaum112k
Comment: C: Error while running BWA mem
... I met the same issue as you.So how do you deal with this error?It is the memory no enough to compute or the reference is not complete or any other reason?Thanks ! ...
written 7 months ago by whaiyu0620
Comment: C: bwa mem mapping
... Yes,I have checked them ,but there's nothing wrong have been reported. ...
written 7 months ago by whaiyu0620
Comment: C: bwa mem mapping
... I used 32 threads ,8 cpu cores of the Linux server to map the reads.I don't know the other config of the machine ,but if it is necessary I'll check them.Thank you! ...
written 7 months ago by whaiyu0620
Comment: C: bwa mem mapping
... the command line I used is:`nohup bwa mem -t 4 -M -R "@RG\tID:A01-2m-B8\tSM:A01-2m-B8\tPL:illumina\tLB:lib1\tPU:unit1" /public1/data/reference/public/Homo_sapiens_assembly19.fasta /public1/barcode/WGS_SC/PF_data/SingleCellAnal/trimmed.A01-2m-B8_R1.fastq.gz /public1/barcode/WGS_SC/PF_data/SingleCellA ...
written 7 months ago by whaiyu0620 • updated 7 months ago by genomax56k
bwa mem mapping multi-thread/single thread
... Hi everyone : I used the software cutadapt to remove the adapter after I received the raw data from sequencing company.(The command is: cutadapt \ -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \ -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \ ...
alignment sequencing written 7 months ago by whaiyu0620 • updated 7 months ago by genomax56k
Comment: C: How to map reads to tiny reference using bowtie2
... Thanks for your reply.It is not appropriate for bowtie2 to align the longer reads to short ref. I have used blast to search the aligned sequences,but don't consider the quality of sequences in this way. Furthermore,I don't understand how to operate the second strategy, you means it is also don't t ...
written 16 months ago by whaiyu0620

Latest awards to whaiyu06

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1547 users visited in the last hour