User: whaiyu06

gravatar for whaiyu06
whaiyu0610
Reputation:
10
Status:
New User
Location:
Last seen:
3 months ago
Joined:
2 years ago
Email:
w*******@163.com

Posts by whaiyu06

<prev • 15 results • page 1 of 2 • next >
0
votes
1
answer
229
views
1
answers
Comment: C: GATK IndelRealigner make mistakes
... I solved this issue by adding another parameter -filterNoBases. Thanks for your advice. ...
written 3 months ago by whaiyu0610
0
votes
1
answer
229
views
1
answers
Comment: C: GATK IndelRealigner make mistakes
... Thanks.There nothing output as your command. ...
written 3 months ago by whaiyu0610
0
votes
1
answer
229
views
1
answer
GATK IndelRealigner make mistakes
... hello, I used the command to realignment around indels.The command as follows: java -jar /Software/GenomeAnalysisTK-3.6/GenomeAnalysisTK.jar \ -R $ref \ -T IndelRealigner \ -targetIntervals A01-2m-B8_merge.mark.intervals \ -I A01-2m-B8_merge.mark.bam \ -o A01-2m-B8_merge ...
alignment sequencing written 4 months ago by whaiyu0610 • updated 4 months ago by Pierre Lindenbaum108k
5
votes
1
answer
370
views
5 follow
1
answer
Picard MarkDuplicates /SAM validation error
... Hello,everyone I used Picardtools/MarkDuplicates as following: java -jar picard.jar \ INPUT=A01-2m-D6.sort.bam \ OUTPUT=A01-2m-D6.bam \ METRICS_FILE=A01-2m-D6.metrics CREATE_INDEX=true 2>A01-2m-D6.picard_MarkDuplicates.stderr then I met thus error: picard.sam.mar ...
alignment sequencing written 4 months ago by whaiyu0610 • updated 4 months ago by Pierre Lindenbaum108k
0
votes
0
answers
6.4k
views
0
answers
Comment: C: Error while running BWA mem
... I met the same issue as you.So how do you deal with this error?It is the memory no enough to compute or the reference is not complete or any other reason?Thanks ! ...
written 4 months ago by whaiyu0610
0
votes
0
answers
403
views
0
answers
Comment: C: bwa mem mapping
... Yes,I have checked them ,but there's nothing wrong have been reported. ...
written 4 months ago by whaiyu0610
0
votes
0
answers
403
views
0
answers
Comment: C: bwa mem mapping
... I used 32 threads ,8 cpu cores of the Linux server to map the reads.I don't know the other config of the machine ,but if it is necessary I'll check them.Thank you! ...
written 4 months ago by whaiyu0610
0
votes
0
answers
403
views
0
answers
Comment: C: bwa mem mapping
... the command line I used is:`nohup bwa mem -t 4 -M -R "@RG\tID:A01-2m-B8\tSM:A01-2m-B8\tPL:illumina\tLB:lib1\tPU:unit1" /public1/data/reference/public/Homo_sapiens_assembly19.fasta /public1/barcode/WGS_SC/PF_data/SingleCellAnal/trimmed.A01-2m-B8_R1.fastq.gz /public1/barcode/WGS_SC/PF_data/SingleCellA ...
written 4 months ago by whaiyu0610 • updated 4 months ago by genomax49k
0
votes
0
answers
403
views
0
answers
bwa mem mapping multi-thread/single thread
... Hi everyone : I used the software cutadapt to remove the adapter after I received the raw data from sequencing company.(The command is: cutadapt \ -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \ -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \ ...
alignment sequencing written 4 months ago by whaiyu0610 • updated 4 months ago by genomax49k
0
votes
1
answer
406
views
1
answers
Comment: C: How to map reads to tiny reference using bowtie2
... Thanks for your reply.It is not appropriate for bowtie2 to align the longer reads to short ref. I have used blast to search the aligned sequences,but don't consider the quality of sequences in this way. Furthermore,I don't understand how to operate the second strategy, you means it is also don't t ...
written 13 months ago by whaiyu0610

Latest awards to whaiyu06

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1670 users visited in the last hour