User: rm16

gravatar for rm16
New User
Last seen:
4 years, 1 month ago
4 years, 5 months ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by rm16

<prev • 12 results • page 1 of 2 • next >
Convert BLAT to GFF file?
... Does anyone know of a handy script to convert a PSL file from a BLAT alignment to a GFF annotation file? It seems like a PSL has all of the information needed to build a GFF file, but I cannot seem to find a script out there to do the dirty work for me. ...
psl annotation gff alignment blat written 4.2 years ago by rm160 • updated 9 months ago by pengchy430
Comment: C: Remove repetitive sequence of variable length from reads
... I was able to figure it out using extended regular expressions and just running a couple of different scripts to make sure I removed every repetitive instance: sed -E 's/^CCCCAAAA*//g' file.fasta Thanks a lot, everyone. ...
written 4.2 years ago by rm160
Remove repetitive sequence of variable length from reads
... I am working with a FASTA file in which each read contains a repetitive sequence of variable length at the 5' end. For instance, in the below file: >seq1 CCCCAAAACCCCAAAACCCCGATGATCATGGATC >seq2 CCCCAAAACCCCGATGGCATCATTCA >seq3 CCCCAAAACCCCAAAATATGTTGCTACTAG I woul ...
fasta osx sequencing written 4.2 years ago by rm160 • updated 4.2 years ago by igor11k
Comment: C: awk to clip off telomeres
... That sounds like a good starting place. I think I can adapt this. Thanks a lot! ...
written 4.2 years ago by rm160
Comment: C: awk to clip off telomeres
... That seems pretty handy. Thank you for the tip. I'll try it out. ...
written 4.2 years ago by rm160
awk to clip off telomeres
... I want to use the Mac OSX terminal to clip repetitive sequences from the beginning of the each sequence in a fasta file. For example, I would like to make the following file: >seq1 CCCCAAAACCCCATGATCATGGATC >seq2 CCCCAAAACCCCATGGCATCATTCA >seq3 CCCCAAAACCCCATGTTGCTA ...
telomere fasta osx terminal awk written 4.2 years ago by rm160 • updated 4.2 years ago by Farbod3.3k
Comment: C: Error: segment-based junction search failed with err =-5
... I'm having this same problem now. Any resolution? ...
written 4.5 years ago by rm160
Comment: C: Tophat error: Bowtie not found on this system
... Sure. I was unclear: I do call it from command line. Read file is located within tophat directory. > tophat genomeIndexPrefix RNAseqReads.fastq ...
written 4.5 years ago by rm160
Comment: C: Tophat error: Bowtie not found on this system
... Ok, just fixed that. Still getting the error though. ...
written 4.5 years ago by rm160
Comment: C: Tophat error: Bowtie not found on this system
... I just gave that a shot, but I am still getting the same error. I also ensured that the path to my bowtie2 index directory is in my PATH variable ...
written 4.5 years ago by rm160

Latest awards to rm16

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1318 users visited in the last hour