User: michaelfaraday

Reputation:
30
Status:
New User
Location:
Last seen:
7 years, 7 months ago
Joined:
7 years, 11 months ago
Email:
y****@hotmail.com

Posts by michaelfaraday

<prev • 9 results • page 1 of 1 • next >
0
votes
0
answers
5.2k
views
0
answers
Comment: C: Picking A Programming Language And Where To Begin
... Claiming that programming should be related to programmer's happiness is a TOTAL lack of respect to a lot of people dedicated to computer programming pedagogy. And YES it hurts to learn programming languages, because 1) you need TIME, and 2) you must un-learn all the bad habits of crappy programming ...
written 7.6 years ago by michaelfaraday30
1
vote
8
answers
4.2k
views
8
answers
Comment: C: C And Fortran Programming Language
... The key factor in learning a programming language is NOT its paradigm, libraries or communities (it could be a million of libraries or programmers and you still have to learn the complexities of an invented language). If arguing for a point based on popularity rather than merit of course then C woul ...
written 7.6 years ago by michaelfaraday30
1
vote
8
answers
4.2k
views
8
answers
Comment: C: C And Fortran Programming Language
... 1) It WAS widely adopted, now it's very hard to find reasons justifying C over other programming languages. 2) C++ is possibly the worst language to learn OOP (check out the Alan Kay comments about C++), 3) It EXTREMELY difficult to interface C libraries, you MUST learn structure types like unions a ...
written 7.6 years ago by michaelfaraday30
0
votes
0
answers
1.6k
views
0
answers
Comment: C: (Determine If Necessary And) How To Realign Blast Results For Arlequin?
... Ok, that's not the raw blast output, each sequence in that list is the alignment string for the database (the HSP_HSEQ node in the XML output) from the blastn, which then I've extracted for grouping (according to information in other databses, linked by accession number) so they can be entered in Ar ...
written 7.9 years ago by michaelfaraday30
0
votes
0
answers
1.6k
views
0
answers
(Determine If Necessary And) How To Realign Blast Results For Arlequin?
... I am newbie in bioinformatics, and now trying to learn about alignments, so sorry about the lack of vocabulary. After blasting a sequence, this is my output from a BLASTN ... lots of other aligns ... AACGTATACGGATCGACTGC AACGTATACGGATCGAC AACGTATACGGATCGACTGC AACGTATACGGATCGAC AACGTATATGGATCGACTGC ...
alignment blast written 7.9 years ago by michaelfaraday30
0
votes
1
answer
1.4k
views
1
answers
Comment: C: When It'S A Sequence And When It'S Not?
... Thanks Chris, so it doesn't make any sense to have a parser for only the sequence letters with no ambiguity X or dashes. Have you (or anyone here) ever need to identify regions with NO ambiguity? ...
written 7.9 years ago by michaelfaraday30
6
votes
1
answer
1.4k
views
1
answer
When It'S A Sequence And When It'S Not?
... I'm just establishing a possible scenario, please feel free to close this question if not realistic. I'm a developer learning molecular biology and fascinated about the world of bioinformatics. Recently I've been asking myself what's the nature of a sequence, but I think it's better if I try to expl ...
sequence written 7.9 years ago by michaelfaraday30 • updated 7.9 years ago by Chris Evelo10.0k
0
votes
1
answer
1.6k
views
1
answers
Comment: C: Mapping Multiple Interval Positions In Bovine Genome
... Thanks for the Liftover link. However your first part of reply confused me even more in the good sense. If a gene might have more than one position, what's a gene then? ...
written 7.9 years ago by michaelfaraday30
2
votes
1
answer
1.6k
views
1
answer
Mapping Multiple Interval Positions In Bovine Genome
... We have an Entrez Gene XML of 2.2Gb of bovine genome (gene_result.xml) and we are trying to map positions between two assemblies. In some cases there are two different positions for the same assembly (see Seq-intervalfrom below), Gene-commentaryversion number is the same and the DTD/XSD NCBI schem ...
ncbi assembly gene written 8.0 years ago by michaelfaraday30 • updated 8.0 years ago by Eric Fournier1.4k

Latest awards to michaelfaraday

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 539 users visited in the last hour