User: fortwatts

gravatar for fortwatts
fortwatts10
Reputation:
10
Status:
New User
Location:
Last seen:
2 years, 9 months ago
Joined:
2 years, 9 months ago
Email:
f********@gmail.com

Posts by fortwatts

<prev • 2 results • page 1 of 1 • next >
1
vote
1
answer
3.9k
views
1
answers
Answer: A: blastn query coverage filter
... I think I have figured this one out. While the total query coverage is >80%, if you actually look at the alignments, there's a series of overlapping HSPs, so the qcov_hsp_perc threshold is not being reached. Lesson learned. ...
written 2.8 years ago by fortwatts10
1
vote
1
answer
3.9k
views
1
answer
blastn query coverage filter
... I have test.fasta consisting of a single header and read: \>why_no_blast_hit CTGATATCTACATACGTACTCGAGCATCGATCGATGACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCGAGCATCGATCGATGTACAGCTACGTACGTCTTGAGCATC ...
blastn blast2.4.0+ qcov_hsp_perc written 2.8 years ago by fortwatts10

Latest awards to fortwatts

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1499 users visited in the last hour