User: fortwatts

gravatar for fortwatts
fortwatts20
Reputation:
20
Status:
New User
Location:
Last seen:
3 years, 2 months ago
Joined:
3 years, 2 months ago
Email:
f********@gmail.com

Posts by fortwatts

<prev • 2 results • page 1 of 1 • next >
2
votes
1
answer
4.8k
views
1
answers
Answer: A: blastn query coverage filter
... I think I have figured this one out. While the total query coverage is >80%, if you actually look at the alignments, there's a series of overlapping HSPs, so the qcov_hsp_perc threshold is not being reached. Lesson learned. ...
written 3.2 years ago by fortwatts20
2
votes
1
answer
4.8k
views
1
answer
blastn query coverage filter
... I have test.fasta consisting of a single header and read: \>why_no_blast_hit CTGATATCTACATACGTACTCGAGCATCGATCGATGACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCGAGCATCGATCGATGTACAGCTACGTACGTCTTGAGCATC ...
blastn blast2.4.0+ qcov_hsp_perc written 3.2 years ago by fortwatts20

Latest awards to fortwatts

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1976 users visited in the last hour