User: dr.genetics

gravatar for dr.genetics
dr.genetics50
Reputation:
50
Status:
New User
Location:
Last seen:
1 year, 2 months ago
Joined:
2 years, 5 months ago
Email:
d**********@yahoo.com

Posts by dr.genetics

<prev • 31 results • page 1 of 4 • next >
1
vote
0
answers
778
views
0
answers
How to retrieve expression data from GEO for matrix files with names starting with "E-"
... First, I cannot make the R package "GEOQuery" work for some of the datasets (it works for some); Second, I've found ways to process matrix files with names starting with "GSE" followed by numbers. However, files such as "E-TABM-145" are different from those starting with "GSE" and I am wondering if ...
gene next-gen rna-seq sequencing written 18 months ago by dr.genetics50
1
vote
0
answers
448
views
0
answers
How is ancestry composition determined?
... I have been wondering how ancestry information is obtained. For example, 23andme & ancestry.com both offer ancestry composition analysis, which tells you how much of you is English, how much is German, etc. Also, there are companies doing ancestry analysis for dogs, which tells you your dog is 1 ...
genome snp written 18 months ago by dr.genetics50
0
votes
1
answer
2.8k
views
1
answers
Comment: C: How to use ggplot2 to display points with gradient color
... Incrdibly awesome! It just worked! ...
written 21 months ago by dr.genetics50
2
votes
1
answer
2.8k
views
1
answer
How to use ggplot2 to display points with gradient color
... A typical scatter plot can display a point with (x, y), as we all know. What I want to do is to associate each point with a gradient color for a 3rd dimension variable varying from 0 to 1. For example, with 1 represented with full red and 0 with no red at all for the 3rd dimension. ...
R written 21 months ago by dr.genetics50
0
votes
1
answer
758
views
1
answers
Comment: C: Free Genetic Genealogy Software
... Awesome! Thanks much! ...
written 2.0 years ago by dr.genetics50
4
votes
1
answer
758
views
1
answer
Free Genetic Genealogy Software
... I am looking for a software that can take SNPs information as input (e.g. a 23andme genomic data file) and haplogroup as output, and ideally with an explanation of the haplogroup. If such a software does not exist, references to algorithms + databases would be also highly appreciated! ...
genome snp written 2.0 years ago by dr.genetics50 • updated 2.0 years ago by Petr Ponomarenko2.6k
0
votes
0
answers
710
views
0
answers
Comment: C: bed file format?
... OK, that explains. Thank you! ...
written 2.3 years ago by dr.genetics50
0
votes
0
answers
710
views
0
answers
Comment: C: bed file format?
... Where did I get the sam files? From fastq files using fq2sam. ...
written 2.3 years ago by dr.genetics50
4
votes
0
answers
710
views
0
answers
bed file format?
... I used "sam2bed" to convert a sam file to a bed file, and the bed file looks like the following: chr1 9995 10070 ATTTGAG_CCCTAAC_TTGAGTT_1 4 - 147 18S34M23S = 10010 -20 TACCCTAACCCTCCCCCTTCCGATAACCCTAACCCTAACCCTAACCCTAACCGTTATTAACATATGACAACTCAA ...
gene next-gen sequencing written 2.3 years ago by dr.genetics50
0
votes
1
answer
988
views
1
answers
Comment: C: How to install kegga for edgeR?
... That's what I thought, but this is what I got: > # differentially expressed genes list > degs <- as.vector(subset(drst, FDR < 0.25)[[1]]) > # do GO analysis > go <- goana(degs, species="Hs"); > ...
written 2.4 years ago by dr.genetics50

Latest awards to dr.genetics

Popular Question 15 months ago, created a question with more than 1,000 views. For featureCounts output interpretation

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2478 users visited in the last hour