User: Srw

gravatar for Srw
Srw10
Reputation:
10
Status:
New User
Location:
Charlottesville, VA
Last seen:
1 year, 2 months ago
Joined:
6 years, 9 months ago
Email:
s****@virginia.edu

Posts by Srw

<prev • 8 results • page 1 of 1 • next >
0
votes
0
answers
434
views
0
answers
mummerplot fails after modifying delta file headers
... I have a filtered delta file that is making a 12x12 comparison. I am successful when plotting the filtered file but the strongest alignments are not on the diagonal when using the -layout preference. I thought it might be because one of my .fasta files uses "chr" and the other uses "Chr". When I cha ...
sed mummer mummerplot written 15 months ago by Srw10
0
votes
2
answers
1.3k
views
2
answers
Comment: C: Sorting .bam file by tag
... Yes, I have permissions and a small number of the files are being written. ...
written 17 months ago by Srw10
0
votes
2
answers
1.3k
views
2
answers
Comment: C: Sorting .bam file by tag
... Sorry this seems to be unclear. I thought I might be running into memory issues because I'm able to make the files to write to but only very few get written before the error "unable to open file tagxxx.bam for writting". My thought was that sorting could be one way to overcome the issue but I may be ...
written 17 months ago by Srw10
0
votes
2
answers
1.3k
views
2
answers
Comment: C: Sorting .bam file by tag
... There are many values for BX so a grep approach would be very slow. I've done `bamtools split -in myfile.bam -tag BX` This splits the original .bam but only writes to a few of them because I'm running into this memory issue which I think is because the file is not correctly sorted by 'BX' ...
written 17 months ago by Srw10
0
votes
2
answers
1.3k
views
2
answers
Comment: C: Sorting .bam file by tag
... Ultimately I want to split by tag but I believe I am running into memory problems because it's not sorted by the tag itself. Here is the first line of my .bam file `ST-K00126:303:HCJNFBBXX:5:2111:5030:25791 65 chr1 9999 0 11S66M50S chr5 18606706 0 TTCTTTTTCTGGATAACCCTAACCCTAACCCTAACCCTAACCCTAACC ...
written 17 months ago by Srw10
0
votes
2
answers
1.3k
views
7 follow
2
answers
Sorting .bam file by tag
... Hi Everyone, I'm trying to split a .bam file by a specific tag but am running into memory issues because the .bam file is position sorted and not tag sorted. I'd like to sort by a tag called 'BX' and cannot find any information in the samtools or bamtools documentation on this. If anyone has any s ...
samtools bamtools sequencing written 17 months ago by Srw10 • updated 14 months ago by cif0770
0
votes
0
answers
572
views
0
answers
BUSCO/Augustus gff2gbSmallDNA very slow
... I have a human assembly that I am running through the BUSCO vertebrate panel. I initially set the CPUs=12 for the BUSCO command. It generated the primary results very fast (a few hours). However, it's now on the gff2gbSmallDNA step (augustus) which is taking a very long time. It's been 48hrs. I can ...
assembly agustus busco written 18 months ago by Srw10
1
vote
1
answer
880
views
1
answer
Differential expression in metabolomics data
... I have a data set of normalized metabolomic values from the company Metabolon. I wanted to perform a differential expression analysis, in R, between 5 cases and 5 controls for ~700 metabolites; however, I cannot find anything that seems to be straight forward. I have looked at CRAN and Bioconductor ...
metabolomics R differential expression written 22 months ago by Srw10 • updated 7 months ago by raghavsehgal19950

Latest awards to Srw

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 664 users visited in the last hour