User: Srw

gravatar for Srw
New User
Charlottesville, VA
Last seen:
1 month ago
7 years, 2 months ago

Posts by Srw

<prev • 9 results • page 1 of 1 • next >
5 follow
Finding 16 mer not present in GRCh38
... I'm interested in creating list of kmers with length of 16 that are NOT present in the human reference GRCh38. I've attempted to use `jellyfish` but the lower limit for this approach is 1. Any thoughts or examples on approaches would be greatly appreciated. ...
genome kmer written 4 weeks ago by Srw10 • updated 4 weeks ago by ATpoint12k
mummerplot fails after modifying delta file headers
... I have a filtered delta file that is making a 12x12 comparison. I am successful when plotting the filtered file but the strongest alignments are not on the diagonal when using the -layout preference. I thought it might be because one of my .fasta files uses "chr" and the other uses "Chr". When I cha ...
sed mummer mummerplot written 20 months ago by Srw10
Comment: C: Sorting .bam file by tag
... Yes, I have permissions and a small number of the files are being written. ...
written 22 months ago by Srw10
Comment: C: Sorting .bam file by tag
... Sorry this seems to be unclear. I thought I might be running into memory issues because I'm able to make the files to write to but only very few get written before the error "unable to open file tagxxx.bam for writting". My thought was that sorting could be one way to overcome the issue but I may be ...
written 22 months ago by Srw10
Comment: C: Sorting .bam file by tag
... There are many values for BX so a grep approach would be very slow. I've done `bamtools split -in myfile.bam -tag BX` This splits the original .bam but only writes to a few of them because I'm running into this memory issue which I think is because the file is not correctly sorted by 'BX' ...
written 22 months ago by Srw10
Comment: C: Sorting .bam file by tag
... Ultimately I want to split by tag but I believe I am running into memory problems because it's not sorted by the tag itself. Here is the first line of my .bam file `ST-K00126:303:HCJNFBBXX:5:2111:5030:25791 65 chr1 9999 0 11S66M50S chr5 18606706 0 TTCTTTTTCTGGATAACCCTAACCCTAACCCTAACCCTAACCCTAACC ...
written 22 months ago by Srw10
8 follow
Sorting .bam file by tag
... Hi Everyone, I'm trying to split a .bam file by a specific tag but am running into memory issues because the .bam file is position sorted and not tag sorted. I'd like to sort by a tag called 'BX' and cannot find any information in the samtools or bamtools documentation on this. If anyone has any s ...
samtools bamtools sequencing written 22 months ago by Srw10 • updated 19 months ago by cif0770
BUSCO/Augustus gff2gbSmallDNA very slow
... I have a human assembly that I am running through the BUSCO vertebrate panel. I initially set the CPUs=12 for the BUSCO command. It generated the primary results very fast (a few hours). However, it's now on the gff2gbSmallDNA step (augustus) which is taking a very long time. It's been 48hrs. I can ...
assembly agustus busco written 23 months ago by Srw10
Differential expression in metabolomics data
... I have a data set of normalized metabolomic values from the company Metabolon. I wanted to perform a differential expression analysis, in R, between 5 cases and 5 controls for ~700 metabolites; however, I cannot find anything that seems to be straight forward. I have looked at CRAN and Bioconductor ...
metabolomics R differential expression written 2.2 years ago by Srw10 • updated 12 months ago by raghavsehgal19950

Latest awards to Srw

Popular Question 19 months ago, created a question with more than 1,000 views. For Differential expression in metabolomics data
Popular Question 19 months ago, created a question with more than 1,000 views. For Sorting .bam file by tag


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1678 users visited in the last hour