User: Zhixue

gravatar for Zhixue
Zhixue10
Reputation:
10
Status:
New User
Location:
China/Shanghai/TJ
Website:
http://www.github.com/...
Last seen:
5 days, 9 hours ago
Joined:
2 years, 8 months ago
Email:
x*******@foxmail.com

Posts by Zhixue

<prev • 12 results • page 1 of 2 • next >
0
votes
1
answer
155
views
1
answers
Comment: A: How to align 10X R1 and R2 fastqs?
... You can align paired-end data directly (two lanes or merge into one if possible accorrding to your knowledge) or transform it to single-end one (might lose paired imformation) like ``` @read1/1 xxx xxx xxx ...... @read1/2 xxx xxx xxx ``` use the command like ```shell zcat sample_1.fq.gz | awk '{i ...
written 11 days ago by Zhixue10
1
vote
1
answer
459
views
1
answers
Answer: A: Fusion gene detection tool
... STAR-FUSION, tophat-fusion, fusioncatcher and so on. ...
written 9 months ago by Zhixue10
0
votes
1
answer
279
views
1
answers
Comment: C: No fusion gene information is avaiable in COSMIC cell lines browser
... Thank you a lot! Perhaps it was a common problem. I may try to contact them after finishing my current work. ...
written 13 months ago by Zhixue10
0
votes
1
answer
279
views
1
answer
No fusion gene information is avaiable in COSMIC cell lines browser
... [COSMIC Cell Lines Project v85](https://cancer.sanger.ac.uk/cell_lines) was released on 08-MAY-2018. A great deal of specific cell lines' variant information is presented in the browser. However, my friend was interested in the fusion gene information of different cell lines, but he found no fusio ...
cell line fusion gene cosmic written 13 months ago by Zhixue10 • updated 13 months ago by Denise - Open Targets5.0k
0
votes
1
answer
491
views
1
answers
Comment: C: How to process ABI SOLID4 fastq
... Thank you very much, I have got the point~ ...
written 15 months ago by Zhixue10
1
vote
1
answer
491
views
1
answer
How to process ABI SOLID4 fastq
... I downloaded a sample of single-end length 50bp RNA-seq with ABI SOLID4 platform from GEO, its fastq file seems like this: ```@SAMPLE1.41421928``` ```T20210231231233023100313033020103033311231200111.22``` ```+``` ```!:5967<<9;967;:7;:797759569987*1563$8,6,2)1&.&,,!4% ``` Ho ...
fastq abi solid4 written 15 months ago by Zhixue10 • updated 15 months ago by h.mon26k
0
votes
2
answers
952
views
2
answers
Answer: A: BAM File Export Coverage Values from IGV or using PySam/Samtools
... It seem that pysam can get the coverage values(as well as the proportion of each base (A, C, G, T), insertions and deletions), but it's not the best choice if there are some more convenient python packages. for example: > SRR3239808.3377 16 chr2 812 60 13S29M * 0 0 CCGCGCCACCACCGCGGACTCCGCTCCCCG ...
written 15 months ago by Zhixue10
0
votes
3
answers
347
views
3
answers
Answer: A: What's the difference between 'clipping' and 'unmapped' and 'skipped'?
... Unmapped information always shows in FLAG with 0x4, with no information in CIGAR. clipping(S/H) and skipped(N) information shows in CIGAR. ---- *Taking an example*, 1. if read **A** is unmapped, it's FLAG includes 4(Bit) and it's CIGAR is '*'. 2. if read **A** is mapped, but only part of it is ...
written 15 months ago by Zhixue10
0
votes
2
answers
1.4k
views
2
answers
Answer: A: How to use pysam to execute "samtools fastq xxx.sam>xxx.fastq"
... ADD COMMENT It is pity that the add comment/add reply button may go wrong in my Google/Firefox browser. To Matt Shirley: Thank you very much , simplesam is good but I have found the solution of this question. When I use ``` samtools fastq xxx.sam>xxx.fastq ``` ,the standard output includes th ...
written 16 months ago by Zhixue10
0
votes
2
answers
1.4k
views
2
answers
Comment: A: How to use pysam to execute "samtools fastq xxx.sam>xxx.fastq"
... I would like to write a python script by pysam with lots of complex filtering steps which include a step of "sam "to "fastq". It ls said that Pysam can use samtools commands(but I only find an example of sort in the manual). If I am not able to find a solution of this question,I may put samtools in ...
written 16 months ago by Zhixue10

Latest awards to Zhixue

Popular Question 9 months ago, created a question with more than 1,000 views. For How to use pysam to execute "samtools fastq xxx.sam>xxx.fastq"

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2064 users visited in the last hour