User: Andrew Veale

gravatar for Andrew Veale
Andrew Veale10
Reputation:
10
Status:
New User
Location:
Scholar ID:
Google Scholar Page
Last seen:
2 years, 10 months ago
Joined:
3 years, 4 months ago
Email:
a*************@gmail.com

Posts by Andrew Veale

<prev • 4 results • page 1 of 1 • next >
1
vote
1
answer
1.0k
views
1
answers
Answer: A: Error in .bim format for plink
... I have found the cause of the error - my plink version was old and therefore couldn't handle the datafile. Now fixed. Thanks! ...
written 2.9 years ago by Andrew Veale10
0
votes
1
answer
1.0k
views
1
answers
Comment: A: Error in .bim format for plink
... As the formatting of that is unclear I will re-enter it. Here are the first three lines of the .bim file (each starting with 1). 1 UNC6 0.000931264046131699 3010274 T C haplotype_discrimination TRUE TRUE TRUE 1 rs31443144 CTGTTTAAAACCTGAAAATGGAAATAGAAGCAATAAAGACATCACAAACT NA 1 UNCJPD00000 ...
written 2.9 years ago by Andrew Veale10 • updated 2.9 years ago by genomax80k
1
vote
1
answer
1.0k
views
1
answer
Error in .bim format for plink
... I am new to Plink, and have some mouse data from the gigamuga sequencing platform, which I have combined in the R package argyle. When I try to run these plink files in plink, it comes up with the error: There is an error in line 2 of the bim file. The bim file starts as such: 1 UNC6 0.000931 ...
software error argyle plink written 2.9 years ago by Andrew Veale10
0
votes
2
answers
1.8k
views
2
answers
Admixture - Abort trap: 6
... I have just installed Admixture, and it fails to run on my data files, giving the following output: ou056055:public veaan84p$ ./admixture --cv public.mm.bysubspecies.bed 5 **** ADMIXTURE Version 1.3.0 **** **** Copyright 2008-2015 ...
software error written 3.4 years ago by Andrew Veale10 • updated 7 weeks ago by beausoleilmo300

Latest awards to Andrew Veale

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1334 users visited in the last hour