User: kdc15

gravatar for kdc15
New User
Last seen:
1 year ago
3 years, 8 months ago

Posts by kdc15

<prev • 22 results • page 1 of 3 • next >
Comment: C: GSEA- can't create a gene set GRP file
... I had saved the file as tab-delimited and then added the .gct extension. Is it not sufficient to do it this way? ...
written 13 months ago by kdc1540
Comment: C: GSEA- can't create a gene set GRP file
... according to the GMT requirements, I organised my genes across like this genename na SEMA3C DIO2 VCAN CPA4 CXCL8 CHRNA6 CXCL6 PI16 CHPF TSPAN8 CD69 HAS2 ANOS1 IGFBP5 TAGLN etc. my dataset in the .gct format is organised as follows: #1.2 27115 2 Gene_Symbol Description ...
written 13 months ago by kdc1540
Comment: C: GSEA- can't create a gene set GRP file
... Even when I format to GMT, I still get the same error ...
written 13 months ago by kdc1540
Comment: C: GSEA- can't create a gene set GRP file
... Thank you for your response. I have double checked the GRP format. It seems to be in order (one gene per line, HUGO approved etc.). Will the GMT format be applicable as I only have one gene set? ...
written 13 months ago by kdc1540
GSEA- can't create a gene set GRP file
... I am trying to run GSEA on a list of differentially expressed genes (control vs. treated) however, I would like to perform this against a list of genes that I provide. I have converted my gene list to GRP file format, and I have also run the list through HUGO and filtered it to make sure that they a ...
geneset grp gsea written 13 months ago by kdc1540
Comment: C: find transcription factor binding site with small sequence from UCSC
... Hi, No you are correct, MotifbreakR will be needed to predict TF binding from the SNP. I wanted to first identfiy what motifs were present in this sequence, but wanted to provide context as to why I was searching such a small sequence. ...
written 15 months ago by kdc1540
find transcription factor binding site with small sequence from UCSC
... I am trying to identify whether a SNP will affect TF binding. Here is the DNA sequence that I have obtained: >hg19_dna range=chr21:39819567-39819957 5'pad=0 3'pad=0 strand=+ repeatMasking=none TAGACTTAGTCATGCTAATTAAGACAAAAATTAGACCTTATTAAAAAATT TTTGCAAAACAGATACTCCCTTCCCATGGTGGCACTGGC ...
bindingsite motif ucsc written 15 months ago by kdc1540 • updated 15 months ago by geek_y11k
Comment: C: Can't locate Bowtie2 index files
... Thank you, I have managed to do this now. Looks like I was using Bowtie1 instead of Bowtie2 ...
written 16 months ago by kdc1540
Comment: C: Can't locate Bowtie2 index files
... Thank you, this helped!! ...
written 16 months ago by kdc1540
Comment: C: Can't locate Bowtie2 index files
... I got the files from this page under pre-built indexes: ...
written 16 months ago by kdc1540

Latest awards to kdc15

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1784 users visited in the last hour