User: kdc15

gravatar for kdc15
kdc1530
Reputation:
30
Status:
New User
Location:
Last seen:
2 days, 19 hours ago
Joined:
2 years, 6 months ago
Email:
k********@hotmail.co.uk

Posts by kdc15

<prev • 17 results • page 1 of 2 • next >
0
votes
2
answers
73
views
2
answers
Comment: C: find transcription factor binding site with small sequence from UCSC
... Hi, No you are correct, MotifbreakR will be needed to predict TF binding from the SNP. I wanted to first identfiy what motifs were present in this sequence, but wanted to provide context as to why I was searching such a small sequence. ...
written 6 days ago by kdc1530
2
votes
2
answers
73
views
2
answers
find transcription factor binding site with small sequence from UCSC
... I am trying to identify whether a SNP will affect TF binding. Here is the DNA sequence that I have obtained: >hg19_dna range=chr21:39819567-39819957 5'pad=0 3'pad=0 strand=+ repeatMasking=none TAGACTTAGTCATGCTAATTAAGACAAAAATTAGACCTTATTAAAAAATT TTTGCAAAACAGATACTCCCTTCCCATGGTGGCACTGGC ...
bindingsite motif ucsc written 6 days ago by kdc1530 • updated 6 days ago by geek_y9.6k
1
vote
1
answer
183
views
1
answers
Comment: C: Can't locate Bowtie2 index files
... Thank you, I have managed to do this now. Looks like I was using Bowtie1 instead of Bowtie2 ...
written 7 weeks ago by kdc1530
0
votes
1
answer
183
views
1
answers
Comment: C: Can't locate Bowtie2 index files
... Thank you, this helped!! ...
written 7 weeks ago by kdc1530
0
votes
1
answer
183
views
1
answers
Comment: C: Can't locate Bowtie2 index files
... I got the files from this page under pre-built indexes: http://bowtie-bio.sourceforge.net/tutorial.shtml#preb ...
written 7 weeks ago by kdc1530
5
votes
1
answer
183
views
1
answer
Can't locate Bowtie2 index files
... Hi, I am trying to align my sequences to a reference genome but Bowtie2 is having trouble locating the index files that I downloaded from Illumina. I am working on a server and have read instructions about moving the files to the bowtie2 index subdirectory, however, this does not exist. It also sa ...
bowtie2 alignment chip-seq written 7 weeks ago by kdc1530 • updated 7 weeks ago by flogin80
0
votes
0
answers
83
views
0
answers
difference between expectation maximisation and hypergeometric distribution for motif finding
... Would someone be able to explain what are the differences in these two algorithms for motif finding? I am having trouble fully understanding what are the main differences, and which is a better approach to use. ...
motif hypergeometric distribution em written 10 weeks ago by kdc1530
0
votes
1
answer
244
views
1
answers
Comment: C: Customising bedtools shuffle command
... for my -incl option I have selected the mappable regions (with a CRG score of 1) of the genome. Is it better to replace this with my enhancer file? ...
written 3 months ago by kdc1530
1
vote
1
answer
244
views
1
answer
Customising bedtools shuffle command
... Hi, I am trying to use the bedtools shuffle command to shuffle transcription factor binding locations. However, I was wondering if the "genome" option could be interchangeable with my own customised file of enhancers? Is it possible to have a file like this in the same format? ...
bedtools enhancers shuffle transcription factors written 3 months ago by kdc1530 • updated 3 months ago by geek_y9.6k
3
votes
0
answers
156
views
0
answers
(Closed) Filter .bed file by numbers in final column
... Hi, I would like to filter a .bed file by numbers in the last column: chr1 0 14400 18 chr1 14400 19000 6 chr1 19000 567400 18 chr1 567400 567800 10 chr1 567800 713200 18 chr1 713200 713800 2 chr1 713800 714600 1 chr1 714600 715400 2 chr1 715400 724000 6 Ho ...
bed sequence genomic file filter written 4 months ago by kdc1530

Latest awards to kdc15

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1113 users visited in the last hour