User: kdc15

gravatar for kdc15
kdc1530
Reputation:
30
Status:
New User
Location:
Last seen:
4 months, 3 weeks ago
Joined:
3 years ago
Email:
k********@hotmail.co.uk

Posts by kdc15

<prev • 22 results • page 1 of 3 • next >
0
votes
0
answers
203
views
0
answers
Comment: C: GSEA- can't create a gene set GRP file
... I had saved the file as tab-delimited and then added the .gct extension. Is it not sufficient to do it this way? ...
written 5 months ago by kdc1530
0
votes
0
answers
203
views
0
answers
Comment: C: GSEA- can't create a gene set GRP file
... according to the GMT requirements, I organised my genes across like this genename na SEMA3C DIO2 VCAN CPA4 CXCL8 CHRNA6 CXCL6 PI16 CHPF TSPAN8 CD69 HAS2 ANOS1 IGFBP5 TAGLN etc. my dataset in the .gct format is organised as follows: #1.2 27115 2 Gene_Symbol Description ...
written 5 months ago by kdc1530
0
votes
0
answers
203
views
0
answers
Comment: C: GSEA- can't create a gene set GRP file
... Even when I format to GMT, I still get the same error ...
written 5 months ago by kdc1530
0
votes
0
answers
203
views
0
answers
Comment: C: GSEA- can't create a gene set GRP file
... Thank you for your response. I have double checked the GRP format. It seems to be in order (one gene per line, HUGO approved etc.). Will the GMT format be applicable as I only have one gene set? ...
written 5 months ago by kdc1530
0
votes
0
answers
203
views
0
answers
GSEA- can't create a gene set GRP file
... I am trying to run GSEA on a list of differentially expressed genes (control vs. treated) however, I would like to perform this against a list of genes that I provide. I have converted my gene list to GRP file format, and I have also run the list through HUGO and filtered it to make sure that they a ...
geneset grp gsea written 5 months ago by kdc1530
0
votes
2
answers
224
views
2
answers
Comment: C: find transcription factor binding site with small sequence from UCSC
... Hi, No you are correct, MotifbreakR will be needed to predict TF binding from the SNP. I wanted to first identfiy what motifs were present in this sequence, but wanted to provide context as to why I was searching such a small sequence. ...
written 6 months ago by kdc1530
2
votes
2
answers
224
views
2
answers
find transcription factor binding site with small sequence from UCSC
... I am trying to identify whether a SNP will affect TF binding. Here is the DNA sequence that I have obtained: >hg19_dna range=chr21:39819567-39819957 5'pad=0 3'pad=0 strand=+ repeatMasking=none TAGACTTAGTCATGCTAATTAAGACAAAAATTAGACCTTATTAAAAAATT TTTGCAAAACAGATACTCCCTTCCCATGGTGGCACTGGC ...
bindingsite motif ucsc written 6 months ago by kdc1530 • updated 6 months ago by geek_y10k
1
vote
1
answer
665
views
1
answers
Comment: C: Can't locate Bowtie2 index files
... Thank you, I have managed to do this now. Looks like I was using Bowtie1 instead of Bowtie2 ...
written 8 months ago by kdc1530
0
votes
1
answer
665
views
1
answers
Comment: C: Can't locate Bowtie2 index files
... Thank you, this helped!! ...
written 8 months ago by kdc1530
0
votes
1
answer
665
views
1
answers
Comment: C: Can't locate Bowtie2 index files
... I got the files from this page under pre-built indexes: http://bowtie-bio.sourceforge.net/tutorial.shtml#preb ...
written 8 months ago by kdc1530

Latest awards to kdc15

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 814 users visited in the last hour