User: crimsontabaq

gravatar for crimsontabaq
crimsontabaq40
Reputation:
40
Status:
New User
Location:
Russia, Kazan Federal University
Last seen:
15 hours ago
Joined:
6 months, 2 weeks ago
Email:
c***********@yandex.ru

Data is to Big for me yet

Posts by crimsontabaq

<prev • 8 results • page 1 of 1 • next >
2
votes
1
answer
84
views
1
answer
EvidentialGene reduces redundancy of de novo transcriptome assembly?
... Hi! Since trinity output assembly ('original') has had a lot of duplicated matches with BLASTx, we decided to try reducing redundancy with tr2aacds script from [EvidentialGene][1] project. tr2aacds filters and merges contigs according to their coding potential and % of identity - sounds more legit ...
assembly transcriptome rna-seq trinity redundancy written 18 hours ago by crimsontabaq40 • updated 9 hours ago by gilbert.bionet40
0
votes
1
answer
141
views
1
answers
Comment: C: GSEA produces too few enriched sets
... We blastx'ed our transcripts against proteins of a relative organism, which genes are classified into KEGG pathways, so we can now group matching transcripts to these pathways. There's strong evidence for some groups to be enriched with DEGs based on previous experiments, but they ain't. ...
written 6 days ago by crimsontabaq40
0
votes
1
answer
141
views
1
answer
GSEA produces too few enriched sets
... Here's a transcriptome of a non-model organism. Comparing two conditions, kallisto generated ~6000 differentially expressed genes. KEGG metabolic pathways of a relative organism were used to classify DEGs and check pathways enrichment. These categories are relatively small (3-100 genes/set). Whilst ...
kallisto gsea transcriptome written 7 days ago by crimsontabaq40 • updated 6 days ago by kristoffer.vittingseerup100
1
vote
1
answer
373
views
1
answers
Comment: C: Duplicated terminal-version BLAST results
... It works! with latest blast: blastx -db BlastDB -query assembly.fa -max_target_seqs 1 -max_hsps 1 -num_threads 8 -evalue 1e-6 -outfmt 6 This job gave me little bit more results than blast-2.2.28 output sorted with 'uniq' command, yet without any double-hsps. Dziękuję! ...
written 6 months ago by crimsontabaq40
1
vote
1
answer
373
views
1
answers
Comment: C: Duplicated terminal-version BLAST results
... Dobry wieczór! I tried xml and ASN.1 (which is I converted to tabular again - and it gave me the same duplicated results), but it's difficult to me to read these formats, so I can't say if it's the same thing happens with other formats. ---------- Just checked .xml output of blastx2.2.28, same dupl ...
written 6 months ago by crimsontabaq40
0
votes
1
answer
373
views
1
answers
Comment: C: Duplicated terminal-version BLAST results
... This is the text of the error (when I ran it with parameters which I've used for tabular output): > BLAST options error: err:tried to set option (130) and value (1), line > (537). TR60-c0_g1_i1: > AATCGGGTCTTGGGTATGGTACGTTACAAGAATTTCAAGAGATATACTTTATACAGAAGA > GCTATTCACAATACAACTTGAGA ...
written 6 months ago by crimsontabaq40
0
votes
1
answer
373
views
1
answers
Comment: C: Duplicated terminal-version BLAST results
... Unfortunately, no. Blast failed to run with the same parameters to create ASN.1 output, so I removed all parameters but -max_target_seqs, -num_threads, -evalue. I've got the same output (with duplicates) after converting ASN.1 to tabular. ...
written 6 months ago by crimsontabaq40
6
votes
1
answer
373
views
1
answer
Duplicated terminal-version BLAST results
... Hi there! I'm blasting (blastx2.2.28) my assembly to the annotated refseq. Below - the command line I used: blastx -query assembly.fa -out Blast -db BlastCustomDB -num_threads 8 -evalue 1e-6 -best_hit_score_edge 0.05 -best_hit_overhang 0.25 -max_hsps_per_subject 1 -max_target_seqs 1 -outfmt ...
alignment blast written 6 months ago by crimsontabaq40

Latest awards to crimsontabaq

Autobiographer 6 months ago, has more than 80 characters in the information field of the user's profile.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 811 users visited in the last hour