User: sanjalidhole

gravatar for sanjalidhole
Reputation:
0
Status:
New User
Last seen:
2 days, 15 hours ago
Joined:
1 month, 1 week ago
Email:
s***********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by sanjalidhole

<prev • 12 results • page 1 of 2 • next >
0
votes
3
answers
110
views
3
answers
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... i tried it and tht wrks its good i got my solution and people helped me.but i have also tried it my way as i should also learn by myself how to slove a difficulty and then i gave it a try .. i think thts a positive attitude and no harm to anyone.thnks ...
written 4 days ago by sanjalidhole0
0
votes
3
answers
110
views
3
answers
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... its working fine for my case:) no offence abt confidence ...
written 4 days ago by sanjalidhole0
2
votes
3
answers
110
views
3
answers
Answer: A: curating file with sort(largest to smallest) and then extract unique values
... **my own answer in perl 100% working without any flaws:** #use strict; #use warnings; use Data::Dumper; open(F,"hexa_novel_.txt")||die("file nt found"); open(S,">hexa_novel_counts_final.txt"); %hash=( "CC1_A" => 0, "CC1_B" => 0, "C ...
written 8 days ago by sanjalidhole0
0
votes
3
answers
110
views
3
answers
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... thanks alot its working fine ...
written 8 days ago by sanjalidhole0
0
votes
3
answers
110
views
3
answers
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... **i want seperate results delimited by Searching cagcaccaccaagauucacau for file single file data.tsv**** Searching cagcaccaccaagauucacau: CC2_B 38 CC2_D 156 CC3_B 56 CC2_A 18 CI1_A 30 CI1_B 30 CI1_D 30 Searching ugccuggcuc ...
written 8 days ago by sanjalidhole0
0
votes
3
answers
110
views
3
answers
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... highest count is not considered ...
written 8 days ago by sanjalidhole0
0
votes
3
answers
110
views
3
answers
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... but i need each block to give me separate results particularly.........nt my file as whole i want each library(CC1_A,CC2_B ETC) to have its highest count,as you can see the counts differ for same library. and print each library with following format for each seperate block(paragraph) : ...
written 8 days ago by sanjalidhole0
6
votes
3
answers
110
views
3
answers
curating file with sort(largest to smallest) and then extract unique values
... **i have a file with library-ID-count as follows:** `* Searching cagcaccaccaagauucacau* CC2_B ta_iwgsc_7bs_v1_3148968_39029 33 CC2_B ta_iwgsc_7bs_v1_3150171_39041 38 CC2_D ta_iwgsc_7ds_v1_3966917_41463 156 CC3_B ta_iwgsc_7bs_v1_3148968_41273 56 CC2_A ta_iwgsc_6al_v1_58 ...
next-gen written 8 days ago by sanjalidhole0
0
votes
2
answers
97
views
2
answers
Comment: C: remove sequences with 100% identity from a file having different ids
... simple u have folder with some files. these files have a same format(mentioned above). take a sequence_1 from file_1 say "ugacugacugac" and find this sequence for all files in that folder. now extract all lines matching to "ugacugacugac" in a new file with file name as "ugacugacugac.txt". do this fo ...
written 6 weeks ago by sanjalidhole0
0
votes
2
answers
97
views
2
answers
Comment: C: remove sequences with 100% identity from a file having different ids
... will this work on a folder in which we have file1, file2,file3 etc seq1 in file1 is mapped for all seqs in file1; even to all seqs in file2 seqs,file3 seqs......etc and then output a final file of that sequence_name.txt ...
written 6 weeks ago by sanjalidhole0

Latest awards to sanjalidhole

Scholar 8 days ago, created an answer that has been accepted. For A: curating file with sort(largest to smallest) and then extract unique values

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1002 users visited in the last hour