User: sanjalidhole

gravatar for sanjalidhole
New User
Last seen:
11 months, 1 week ago
1 year, 2 months ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by sanjalidhole

<prev • 12 results • page 1 of 2 • next >
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... i tried it and tht wrks its good i got my solution and people helped me.but i have also tried it my way as i should also learn by myself how to slove a difficulty and then i gave it a try .. i think thts a positive attitude and no harm to anyone.thnks ...
written 13 months ago by sanjalidhole0
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... its working fine for my case:) no offence abt confidence ...
written 13 months ago by sanjalidhole0
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... thanks alot its working fine ...
written 13 months ago by sanjalidhole0
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... **i want seperate results delimited by Searching cagcaccaccaagauucacau for file single file data.tsv**** Searching cagcaccaccaagauucacau: CC2_B 38 CC2_D 156 CC3_B 56 CC2_A 18 CI1_A 30 CI1_B 30 CI1_D 30 Searching ugccuggcuc ...
written 13 months ago by sanjalidhole0
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... highest count is not considered ...
written 13 months ago by sanjalidhole0
Comment: C: curating file with sort(largest to smallest) and then extract unique values
... but i need each block to give me separate results particularly.........nt my file as whole i want each library(CC1_A,CC2_B ETC) to have its highest count,as you can see the counts differ for same library. and print each library with following format for each seperate block(paragraph) : ...
written 13 months ago by sanjalidhole0
curating file with sort(largest to smallest) and then extract unique values
... **i have a file with library-ID-count as follows:** `* Searching cagcaccaccaagauucacau* CC2_B ta_iwgsc_7bs_v1_3148968_39029 33 CC2_B ta_iwgsc_7bs_v1_3150171_39041 38 CC2_D ta_iwgsc_7ds_v1_3966917_41463 156 CC3_B ta_iwgsc_7bs_v1_3148968_41273 56 CC2_A ta_iwgsc_6al_v1_58 ...
next-gen written 13 months ago by sanjalidhole0
Comment: C: remove sequences with 100% identity from a file having different ids
... simple u have folder with some files. these files have a same format(mentioned above). take a sequence_1 from file_1 say "ugacugacugac" and find this sequence for all files in that folder. now extract all lines matching to "ugacugacugac" in a new file with file name as "ugacugacugac.txt". do this fo ...
written 14 months ago by sanjalidhole0
Comment: C: remove sequences with 100% identity from a file having different ids
... will this work on a folder in which we have file1, file2,file3 etc seq1 in file1 is mapped for all seqs in file1; even to all seqs in file2 seqs,file3 seqs......etc and then output a final file of that sequence_name.txt ...
written 14 months ago by sanjalidhole0

Latest awards to sanjalidhole

Scholar 13 months ago, created an answer that has been accepted. For A: curating file with sort(largest to smallest) and then extract unique values


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1599 users visited in the last hour