User: br.tania

gravatar for br.tania
br.tania40
Reputation:
40
Status:
New User
Location:
Last seen:
3 years ago
Joined:
3 years, 7 months ago
Email:
b*******@gmail.com

Posts by br.tania

<prev • 9 results • page 1 of 1 • next >
0
votes
1
answer
1.4k
views
1
answer
Performing liftOver between genome assemblies not available on UCSC genome browser
... Hi All, I have VCF files for 2 different macaque species' (Pig-tailed, Japanese) samples. The aim is to liftOver the VCF from one specie to the other. This can be done with the UCSC Genome Browser except their genome assemblies are not available on the Browser yet. So I need to find a way around i ...
genome assembly sequence written 3.1 years ago by br.tania40 • updated 3.1 years ago by colindaven2.4k
0
votes
0
answers
2.3k
views
0
answers
Comment: C: producing a combined .sam file using *_1.sai and *_2.sai
... I haven't done any quality control. I assumed I was given good quality fastq files - I also have access to the .sra files if needed. I'm not sure if low confidence base calls will result in the errors I mention. Can someone with more experience chip in? Thanks. ...
written 3.5 years ago by br.tania40
0
votes
0
answers
2.3k
views
0
answers
Comment: C: producing a combined .sam file using *_1.sai and *_2.sai
... I just re-formatted it. Thanks for your patience. ...
written 3.5 years ago by br.tania40
0
votes
0
answers
2.3k
views
0
answers
Comment: C: producing a combined .sam file using *_1.sai and *_2.sai
... @ jrj.healey: I am pasting parts of a .fa and .sai files. **sample_1.fa:** beginning @SRR1767736.1.1 ST-E00144:17:H04D6ALXX:1:1101:11221:1309 length=151 TCTTAAGAAATAAATGATAAATGTTTGAGATGATGGATACTCCAGTTACTTAGATTGAATCATTATACATTGTATGTGTGTATCAAAATTTCACATGTGGGCTTGAGATGGTAGTTCTGGCCTGTAATCTCAGCA ...
written 3.5 years ago by br.tania40
1
vote
0
answers
2.3k
views
0
answers
producing a combined .sam file using *_1.sai and *_2.sai
... Hi everyone! I am aligning whole genome sequence paired reads for which I used the following commands: **bwa index ref.fa** **bwa aln ref.fa sample_1.fa > sample_1_aln.sai** **bwa aln ref.fa sample_2.fa > sample_1_aln.sai** **bwa sampe ref.fa sample_1_aln.sai sample_2_aln.sai sample_1 ...
bwa sampe error written 3.5 years ago by br.tania40
0
votes
0
answers
1.2k
views
0
answers
Comment: C: pre-processing whole genome data
... Thanks! I will give a feedback once I try out the suggestions. I actually later also stumbled upon the ncbi repertoire of dbSNPs for macaques. ...
written 3.5 years ago by br.tania40
0
votes
0
answers
1.2k
views
0
answers
pre-processing whole genome data
... Hi everyone! I am new to whole genome analyses. For guidance, I am referring to 'Best Practices for Germline SNP & Indel Discovery in Whole Genome and Exome Sequence'. As of now, I need to call variants in Rhesus Macaque paired-end reads (fasta files). I used the most recent reference genome ...
dbsnp.vcf gatk rhesus macaque written 3.5 years ago by br.tania40 • updated 3.5 years ago by genomax91k
0
votes
1
answer
4.0k
views
1
answers
Comment: A: combining fasta files
... Thanks a lot. That was useful. ...
written 3.5 years ago by br.tania40
10
votes
1
answer
4.0k
views
5 follow
1
answer
combining fasta files
... I have downloaded the assembly fasta files for all chromosomes for an organism from NCBI. Now I want to map my unique data (WGS) to the genome. How to combine the chromosome-wise fasta files to give a fasta file for the whole genome? This needs to be done to run BWA, right? ...
alignment written 3.6 years ago by br.tania40 • updated 2.9 years ago by manishagupta2930

Latest awards to br.tania

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1012 users visited in the last hour