User: jozs2019

gravatar for jozs2019
jozs20190
Reputation:
0
Status:
New User
Last seen:
1 week, 3 days ago
Joined:
2 months, 1 week ago
Email:
j*******@uni.sydney.edu.au

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by jozs2019

<prev • 5 results • page 1 of 1 • next >
0
votes
1
answer
133
views
1
answers
Comment: C: Abyss-fixmate: error: all reads are mateless
... Understood! I wrote this sed script: sed 's|.1 |/1 |g' reads_suffixes_1.fastq ... and it seems to have worked (checking the head and tail again). Fingers crossed that assembly goes better this time, and thanks for your help! ...
written 5 weeks ago by jozs20190
0
votes
1
answer
133
views
1
answers
Comment: C: Abyss-fixmate: error: all reads are mateless
... Thanks for clarifying, benv! The first 10 lines of read 1 file: @SRR960028.1.1 FCC0H3RACXX:5:1101:1479:2095 length=150 TNAGTGAAGGACACCGCTGGATAAAGAATAAAAGGAGATCTTGACAAAAAGAAAAAAGAGGACCTTCAAAAGTAAGGCAAGAAGAGGAGTGGTGAGTTTTCTTATAAATATTAAAAATGGGAGCTAGCAACAGTCGCTTGCCTTTTGTAT +SRR960028.1.1 F ...
written 5 weeks ago by jozs20190
2
votes
1
answer
133
views
1
answer
Abyss-fixmate: error: all reads are mateless
... Hello, I'm trying to assemble contigs from a set of paired end reads, denoted as SRR960028_1.fasta and SRR960028_2.fasta. I'm running ABySS on my university's HPC facility. When I run ABySS it terminates early. The line of code itself (within the PBS file) is: abyss-pe name=abyss_test1 k=63 in ...
genome assembly abyss abyss-fixmate written 5 weeks ago by jozs20190 • updated 5 weeks ago by benv430
0
votes
1
answer
136
views
1
answers
Comment: C: ABySS error: sequence and quality must be the same length near ...
... I had a look at the file, and as you said, line 745672 was truncated in length. It was also the final line of a fastq file that should have had more lines in it. I have the feeling it was a download problem rather than anything else, it's happened in the past that my fastq files have been truncated ...
written 9 weeks ago by jozs20190
1
vote
1
answer
136
views
1
answer
ABySS error: sequence and quality must be the same length near ...
... Hello! I'm trying to use ABySS 1.9.0 to assemble set of genomic paired end reads. I'm doing this on my university's HPC with parallel processing. In my PBS script, I use: abyss-pe name=abyss_test1 k=63 in='SRR960028_1.fastq SRR960028_2.fastq' v=-v Unfortunately, ABySS terminates quite quickly aft ...
genome assembly error abyss written 9 weeks ago by jozs20190 • updated 9 weeks ago by benv430

Latest awards to jozs2019

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 421 users visited in the last hour