User: jozs2019

gravatar for jozs2019
jozs20190
Reputation:
0
Status:
New User
Last seen:
2 months ago
Joined:
4 months ago
Email:
j*******@uni.sydney.edu.au

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by jozs2019

<prev • 5 results • page 1 of 1 • next >
0
votes
1
answer
206
views
1
answers
Comment: C: Abyss-fixmate: error: all reads are mateless
... Understood! I wrote this sed script: sed 's|.1 |/1 |g' reads_suffixes_1.fastq ... and it seems to have worked (checking the head and tail again). Fingers crossed that assembly goes better this time, and thanks for your help! ...
written 3 months ago by jozs20190
0
votes
1
answer
206
views
1
answers
Comment: C: Abyss-fixmate: error: all reads are mateless
... Thanks for clarifying, benv! The first 10 lines of read 1 file: @SRR960028.1.1 FCC0H3RACXX:5:1101:1479:2095 length=150 TNAGTGAAGGACACCGCTGGATAAAGAATAAAAGGAGATCTTGACAAAAAGAAAAAAGAGGACCTTCAAAAGTAAGGCAAGAAGAGGAGTGGTGAGTTTTCTTATAAATATTAAAAATGGGAGCTAGCAACAGTCGCTTGCCTTTTGTAT +SRR960028.1.1 F ...
written 3 months ago by jozs20190
2
votes
1
answer
206
views
1
answer
Abyss-fixmate: error: all reads are mateless
... Hello, I'm trying to assemble contigs from a set of paired end reads, denoted as SRR960028_1.fasta and SRR960028_2.fasta. I'm running ABySS on my university's HPC facility. When I run ABySS it terminates early. The line of code itself (within the PBS file) is: abyss-pe name=abyss_test1 k=63 in ...
genome assembly abyss abyss-fixmate written 3 months ago by jozs20190 • updated 3 months ago by benv500
0
votes
1
answer
197
views
1
answers
Comment: C: ABySS error: sequence and quality must be the same length near ...
... I had a look at the file, and as you said, line 745672 was truncated in length. It was also the final line of a fastq file that should have had more lines in it. I have the feeling it was a download problem rather than anything else, it's happened in the past that my fastq files have been truncated ...
written 4 months ago by jozs20190
1
vote
1
answer
197
views
1
answer
ABySS error: sequence and quality must be the same length near ...
... Hello! I'm trying to use ABySS 1.9.0 to assemble set of genomic paired end reads. I'm doing this on my university's HPC with parallel processing. In my PBS script, I use: abyss-pe name=abyss_test1 k=63 in='SRR960028_1.fastq SRR960028_2.fastq' v=-v Unfortunately, ABySS terminates quite quickly aft ...
genome assembly error abyss written 4 months ago by jozs20190 • updated 4 months ago by benv500

Latest awards to jozs2019

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 650 users visited in the last hour