User: djomlaart

gravatar for djomlaart
djomlaart0
Reputation:
0
Status:
New User
Last seen:
2 years, 5 months ago
Joined:
2 years, 5 months ago
Email:
m***************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by djomlaart

<prev • 3 results • page 1 of 1 • next >
0
votes
2
answers
1.8k
views
2
answers
Comment: C: BWA MAPQ qualities 0 for primary alignments and discordant reads
... basic grep + list of subsequences of interest, but I think it should not be of importance for the question here. The point here is that the shown record is primary alignment but discordant. Should it's MAPQ be zero or not? ...
written 2.5 years ago by djomlaart0
0
votes
2
answers
1.8k
views
2
answers
Comment: C: BWA MAPQ qualities 0 for primary alignments and discordant reads
... Here is the example of one record: `D0MBKACXX120224:7:1302:15153:85170 81 hla_a_01_01_15 1234 0 76M hla_a_23_01_08 1207 0 GCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGGGTACCAGGGGCCACGGGGC AAFBCD?BDFGH@BBGIDGA@>JHBFFCHA@@FDHCEFIDHA@HHCIJDE@FDAAGGG=AGJCGEGHHI>@FFEEB NM:i:0 MD:Z:76 AS: ...
written 2.5 years ago by djomlaart0 • updated 2.5 years ago by genomax71k
3
votes
2
answers
1.8k
views
5 follow
2
answers
BWA MAPQ qualities 0 for primary alignments and discordant reads
... Can it be that because the read pairs are discordant the mapping quality of the first read in pair will be zero? I've pre-filtered my exome data, and then aligned it using BWA-MEM to FASTA made of HLA alleles. Of course I get a lot of multiple mappings, so I filter for primary alignments only. So ...
alignment next-gen sequence written 2.5 years ago by djomlaart0 • updated 2.5 years ago by Charles Plessy2.7k

Latest awards to djomlaart

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1207 users visited in the last hour