User: fatimarasool135

Reputation:
60
Status:
Trusted
Location:
Last seen:
1 month, 1 week ago
Joined:
3 years, 4 months ago
Email:
f**************@gmail.com

Posts by fatimarasool135

<prev • 110 results • page 1 of 11 • next >
0
votes
0
answers
91
views
0
answers
Comment: C: codon changes finding in gene
... Dear Pierre Lindenbaum, now i have change the format of file according to VEP tool. this tool can take the input file as mention in this link [https://plants.ensembl.org/info/docs/tools/vep/vep_formats.html#default] here is my file > 1A 124189766 124189766 GA + > 1A 124189779 124189779 ...
written 6 weeks ago by fatimarasool13560
0
votes
0
answers
91
views
0
answers
Comment: C: codon changes finding in gene
... VEP and SnpEff take the input file as VCF file. I have file in partially bed format contain chr_name, coordinate , allel change..these 3 information only. so this file is not according to input file format of VEP and SnpEff. ...
written 6 weeks ago by fatimarasool13560
0
votes
0
answers
91
views
0
answers
codon changes finding in gene
... Hi, I have to find the codon changes in genes. how can i find ? is there any script or tool for resolving this problem ? I have the coordinate of allele like > 1A 124189778 124189779 and corresponding gene in which > GA changes occurred. the numbers of genes are in hundreds and fi ...
software error R snp rna-seq gene written 6 weeks ago by fatimarasool13560 • updated 6 weeks ago by genomax87k
0
votes
0
answers
96
views
0
answers
RNA Editing sites that leads to codons changes cause the change in amino acid
... Hi, I have detected the RNA editing sites by SPRINT tool. after that i predicted the genes in which editing sites are present by bedops tool and out put file is in bed format and SPRINT output file in res format now. now i want to identify the change in amino acid in genes which is caused by chang ...
rna-seq written 5 months ago by fatimarasool13560 • updated 5 months ago by ATpoint36k
0
votes
0
answers
224
views
0
answers
Comment: C: error in trinity
... the fastq file look like that **`head G2_forward_paired.fq`** @NS500786:42:HW75GBGXX:1:21307:2729:10394 1:N:0:TCCGGAGA+AGGATAGG AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEE66E6666 @NS500786:42:HW75GBGXX:4:11411:6035:6026 ...
written 9 months ago by fatimarasool13560 • updated 9 months ago by lakhujanivijay5.1k
0
votes
0
answers
224
views
0
answers
Comment: C: error in trinty
... Hi, I have run this command > Trinity --seqType fq --left /home/bioinfo/fatima/G2_forward_paired.fq --right /home/bioinfo/fatima/G2_reverse_paired.fq --max_memory 102G --output G2_trinity ...
written 9 months ago by fatimarasool13560
0
votes
0
answers
224
views
0
answers
error in trinity
... hi , I am doing denovo assembly by using trinity. data is not from SRA . .but got these error .how can i resolve it ? > > Error, not recognizing read name formatting: [NS500786:42:HA1AGGAAGACCACGAATTGCCTTGTGAAEEAEEEGXX:2:1210G:7930EAE/EEEEEAE/EAEEEEEE/AAIf your data come from SRA, b ...
assembly alignment rna-seq written 9 months ago by fatimarasool13560
0
votes
0
answers
1.0k
views
0
answers
Comment: C: error in installation of TRinity by conda
... yes. and now i am conecting the system with wifi. but no wifi adeptor found on system. so system is not connecting with wifi. ...
written 9 months ago by fatimarasool13560
1
vote
0
answers
1.0k
views
0
answers
error in installation of TRinity by conda
... HI, I am installing the trinity by following command conda install -c bioconda trinity but unfortunate i am getting this error. Kindly tell me how to resolve it . `ProxyError: Conda cannot proceed due to an error in your proxy configuration. enter code hereCheck for typos and other conf ...
software error assembly rna-seq written 9 months ago by fatimarasool13560
0
votes
1
answer
556
views
1
answers
Comment: C: gene sequence fetching from bam or fastq file of rna seq data
... Hi Buffo, Thank you.I have the gene sequences now.but these are the same sequence as present in database. After sequence alignment i did not any variation in six samples of target gene. why it is same? ...
written 10 months ago by fatimarasool13560

Latest awards to fatimarasool135

Popular Question 3 months ago, created a question with more than 1,000 views. For transcripts assemble by StringTie
Popular Question 4 months ago, created a question with more than 1,000 views. For transcripts assemble by StringTie
Popular Question 6 months ago, created a question with more than 1,000 views. For gatk tool installation problem
Centurion 11 months ago, created 100 posts.
Popular Question 2.2 years ago, created a question with more than 1,000 views. For gatk tool installation problem

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1635 users visited in the last hour