User: fatimarasool135

Reputation:
40
Status:
New User
Location:
Last seen:
22 hours ago
Joined:
2 years, 8 months ago
Email:
f**************@gmail.com

Posts by fatimarasool135

<prev • 107 results • page 1 of 11 • next >
0
votes
0
answers
100
views
0
answers
Comment: C: error in trinity
... the fastq file look like that **`head G2_forward_paired.fq`** @NS500786:42:HW75GBGXX:1:21307:2729:10394 1:N:0:TCCGGAGA+AGGATAGG AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEE66E6666 @NS500786:42:HW75GBGXX:4:11411:6035:6026 ...
written 4 weeks ago by fatimarasool13540 • updated 4 weeks ago by lakhujanivijay4.6k
0
votes
0
answers
100
views
0
answers
Comment: C: error in trinty
... Hi, I have run this command > Trinity --seqType fq --left /home/bioinfo/fatima/G2_forward_paired.fq --right /home/bioinfo/fatima/G2_reverse_paired.fq --max_memory 102G --output G2_trinity ...
written 4 weeks ago by fatimarasool13540
0
votes
0
answers
100
views
0
answers
error in trinity
... hi , I am doing denovo assembly by using trinity. data is not from SRA . .but got these error .how can i resolve it ? > > Error, not recognizing read name formatting: [NS500786:42:HA1AGGAAGACCACGAATTGCCTTGTGAAEEAEEEGXX:2:1210G:7930EAE/EEEEEAE/EAEEEEEE/AAIf your data come from SRA, b ...
assembly alignment rna-seq written 4 weeks ago by fatimarasool13540
0
votes
0
answers
221
views
0
answers
Comment: C: error in installation of TRinity by conda
... yes. and now i am conecting the system with wifi. but no wifi adeptor found on system. so system is not connecting with wifi. ...
written 4 weeks ago by fatimarasool13540
1
vote
0
answers
221
views
0
answers
error in installation of TRinity by conda
... HI, I am installing the trinity by following command conda install -c bioconda trinity but unfortunate i am getting this error. Kindly tell me how to resolve it . `ProxyError: Conda cannot proceed due to an error in your proxy configuration. enter code hereCheck for typos and other conf ...
software error assembly rna-seq written 4 weeks ago by fatimarasool13540
0
votes
1
answer
407
views
1
answers
Comment: C: gene sequence fetching from bam or fastq file of rna seq data
... Hi Buffo, Thank you.I have the gene sequences now.but these are the same sequence as present in database. After sequence alignment i did not any variation in six samples of target gene. why it is same? ...
written 12 weeks ago by fatimarasool13540
0
votes
0
answers
177
views
0
answers
Comment: C: edgeR dispersion value (common BCV (square- root-dispersion)) when no replicates
... Hi ATpoint, I have read vst in the manual of DEseq2. but i could not understand itkindly write command I have compared the samples to each other by using the Deseq2 tool and have list of genes with parameters generated by deseq2 tool. Now i have no chance to take biological replicates. You have tol ...
written 12 weeks ago by fatimarasool13540
1
vote
0
answers
177
views
0
answers
edgeR dispersion value (common BCV (square- root-dispersion)) when no replicates in dataset
... I am performing several analysis of differential expression (using edgeR). Reading edgeR manual I am not sure about BCV value that I should use. I am comparing libraries of the same species (non model species) and i have no biological replicates. In the manual you say that "Typical values for the ...
software error R next-gen rna-seq genome written 12 weeks ago by fatimarasool13540
0
votes
2
answers
901
views
2
answers
Comment: A: biomaRt: Cannot access the zebra fish dataset
... Hi Mike Smith, I am using the biomart package. and i have not seen dataset of wheat. Can you please tell me how to acess the wheat dataset ? ...
written 12 weeks ago by fatimarasool13540
1
vote
0
answers
106
views
0
answers
wheat_gene_ensembl not available on biomaRt
... Hi , I have the STRG gene ids.I want to get the gene names of these genes or ensembl gene ids of wheat . How can I get It? I have read the Biomart package but fond nothing. ...
genome assembly rna-seq gene written 3 months ago by fatimarasool13540

Latest awards to fatimarasool135

Centurion 3 months ago, created 100 posts.
Popular Question 18 months ago, created a question with more than 1,000 views. For gatk tool installation problem

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2075 users visited in the last hour