User: yancychy

gravatar for yancychy
yancychy10
Reputation:
10
Status:
New User
Location:
Last seen:
6 hours ago
Joined:
2 years, 7 months ago
Email:
y*******@gmail.com

Posts by yancychy

<prev • 9 results • page 1 of 1 • next >
0
votes
1
answer
79
views
1
answers
Comment: C: Build repeat genome index using STAR
... Yes. Thanks very much ...
written 15 days ago by yancychy10
1
vote
1
answer
79
views
1
answers
Comment: C: Build repeat genome index using STAR
... Thanks. I tired to limit STAR to 40gb. The error is same. I think the problem may caused by the input files. repeatSeq.fa >hg38_rmsk_L1P5 range=chr1:67108754-67109046 5'pad=0 3'pad=0 strand=+ repeatMasking=none AACAAATAATCCCATCAAAAAGTAGGCAAAGGATATGAATAGATAATTTT CAAAATAAGATATACAAATG ...
written 16 days ago by yancychy10 • updated 14 days ago by h.mon28k
0
votes
1
answer
79
views
1
answers
Comment: A: Build repeat genome index using STAR
... Thanks. I tired the --limitGenomeGenerateRAM. It produced same error. ...
written 16 days ago by yancychy10
2
votes
1
answer
79
views
1
answer
Build repeat genome index using STAR
... Hi , I downloaded the repeat genome and gtf (RepeatMasker) files from UCSC genome table browser. I want to build repeat genome index to remove the reads which may be spurious artifacts from rRNA (& other) repetitive reads. But the error is always exceeding memory limit. I adjust the memory ...
repeat star index written 17 days ago by yancychy10
0
votes
3
answers
768
views
3
answers
Answer: A: How to validate the Gene connections?
... Thank you so much. Petr and badribio, I will try use the databases, Many thanks. ...
written 2.5 years ago by yancychy10
2
votes
3
answers
768
views
3
answers
How to validate the Gene connections?
... Hello, I have built a connection networks of several genes. But I don not know how to validate the correlation between these genes? Is there any gene networks databases which can help me to validate my networks? Many thanks. Best regards, ...
gene genome written 2.6 years ago by yancychy10
0
votes
0
answers
627
views
0
answers
Comment: C: how to get the full mRNA from the coordinate of DNA and transcript id
... I want to get the corresponding RNA sequence for the short position information ...
written 2.6 years ago by yancychy10
0
votes
0
answers
627
views
0
answers
Comment: C: how to get the full mRNA from the coordinate of DNA and transcript id
... Thank you very much. I will try it. I hope I can download the tools and files into local PC, and run the tools to process the bed files ...
written 2.6 years ago by yancychy10
3
votes
0
answers
627
views
0
answers
how to get the full mRNA from the coordinate of DNA and transcript id
... Hi, I want to get the full RNA sequence from the known information as follow: chr1 6582284 6582295 ENSG00000204859 . + ensembl_havana CDS 0 transcript_id "ENST00000377674"; gene_id "ENSG00000204859"; gene_name "ZBTB48"; chr1 6582284 6582295 ENSG00000204859 . + ensembl_havana exon . transcrip ...
rna-seq written 2.6 years ago by yancychy10

Latest awards to yancychy

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1887 users visited in the last hour