User: Javad

gravatar for Javad
Javad90
Reputation:
90
Status:
Trusted
Location:
Last seen:
1 month ago
Joined:
2 years, 11 months ago
Email:
e*************@gmail.com

Posts by Javad

<prev • 52 results • page 2 of 6 • next >
4
votes
1
answer
1.5k
views
5 follow
1
answer
The best way to produce gene body coverage
... Hello every body, Can anyone suggest an approach to produce gene body coverage. I already used qualimap. I am looking for other suggestions. Best ...
rna-seq written 21 months ago by Javad90 • updated 21 months ago by Antonio R. Franco4.4k
0
votes
0
answers
1.1k
views
0
answers
Comment: C: problem in running cutadapt on multiple cores
... Yes. I have 40 cores. ...
written 22 months ago by Javad90
0
votes
0
answers
1.1k
views
0
answers
Comment: C: problem in running cutadapt on multiple cores
... Hello, Here it is: This one works: cutadapt -u 15 -U 5 -m 20 -g GATGGTTGAGGATGTGTGGAG -G GATGGTTGAGGATGTGTGGAG -g TCCACACATCCTCAACCATC -G CTCCACACATCCTCAACCATC -q 25 -o out_R1.fq.bz2 -p out_R2.fq.bz2 /path/to/file/input_R1.fq.bz2 /path/to/file/input_R2.fq.bz2 and this one doesn't: cuta ...
written 22 months ago by Javad90
1
vote
0
answers
1.1k
views
0
answers
problem in running cutadapt on multiple cores
... Dear all, I am trying to use cutadadpt for trimming adapters. It works perfectly when I run it on single core but when I try to use it on multiple cores I get the following error. ERROR: Traceback (most recent call last): File "/home/user/.local/lib/python3.6/site-packages/cutadapt/pipel ...
rna-seq written 22 months ago by Javad90
0
votes
0
answers
999
views
0
answers
How to remove primers from a sequencing run with cutadapt
... Dear all, I would like to use cutadapt to trim the primers from my sequencing run. I was just wondering when I give the sequence of my primer to cutadapt, do I also have to give the complementary sequence as well? for example let's say my primer is: AATC Then is this command "`cutadapt -g AATC in ...
rna-seq written 22 months ago by Javad90
2
votes
1
answer
337
views
1
answer
SNPs identification in Human
... Dear all, I would like to ask you a question regarding identification of SNPs in individuals. I have the exome sequence of around 20 individuals (Human) and I would like to identify the SNPs in the exome of theses persons. I have never worked with SNPs before so I would be grateful if somebody c ...
rna-seq written 23 months ago by Javad90 • updated 23 months ago by genomax80k
2
votes
2
answers
377
views
2
answers
differences in different versions of genomic assemblies
... Hello everybody, Could you please explain what is the difference between different versions of genomics assemblies. I am particularly interested to know when a new version of genomic assemblies is published (for example GRCh37 vs GRCh38), does the coordinates of different genomic features change or ...
rna-seq written 24 months ago by Javad90 • updated 24 months ago by genomax80k
0
votes
3
answers
1.3k
views
3
answers
Comment: C: SNPs in 1000 genome project
... I don't think it would be just a single command. because the coordinates of exons are not included in the vcf file. Am I missing some thing? Could you please give me some hints to go through it? Thanks ...
written 24 months ago by Javad90
0
votes
3
answers
1.3k
views
3
answers
Comment: A: SNPs in 1000 genome project
... Yeah, But I didn't want to write scripts. I thought maybe this data is already stored somewhere. Thank you anyway. ...
written 24 months ago by Javad90
16
votes
3
answers
1.3k
views
8 follow
3
answers
SNPs in 1000 genome project
... Hello every body, I want to have SNPs of 1000 genome project only for exons. The database of 1000 genome project includes SNPs for the whole genome. Is there an easy way to filter and download data only for exons. I don't want to spend time on writing scripts to filter data. I would be grateful if ...
snp written 24 months ago by Javad90 • updated 24 months ago by Alex Reynolds29k

Latest awards to Javad

Popular Question 7 weeks ago, created a question with more than 1,000 views. For The best way to produce gene body coverage
Great Question 10 months ago, created a question with more than 5,000 views. For looking for an R package for GO term analysis
Epic Question 10 months ago, created a question with more than 10,000 views. For looking for an R package for GO term analysis
Popular Question 10 months ago, created a question with more than 1,000 views. For The best way to produce gene body coverage
Popular Question 10 months ago, created a question with more than 1,000 views. For SNPs in 1000 genome project
Popular Question 10 months ago, created a question with more than 1,000 views. For Converting different annotation file formats (GTF/GFF/BED) to each other
Popular Question 10 months ago, created a question with more than 1,000 views. For Demultiplexing bcl files into fastq files
Popular Question 10 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Student 10 months ago, asked a question with at least 3 up-votes. For how to produce plots like this in R
Popular Question 11 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Popular Question 13 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Popular Question 13 months ago, created a question with more than 1,000 views. For How to manipulate a gff or gtf file manually?
Popular Question 14 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Popular Question 14 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Great Question 16 months ago, created a question with more than 5,000 views. For looking for an R package for GO term analysis
Popular Question 16 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Popular Question 16 months ago, created a question with more than 1,000 views. For looking for an R package for GO term analysis
Popular Question 16 months ago, created a question with more than 1,000 views. For RNA spike-ins: Their applications and bioinformatics methods for the analysis
Popular Question 20 months ago, created a question with more than 1,000 views. For htseq-count output file
Popular Question 20 months ago, created a question with more than 1,000 views. For htseq-count output file
Popular Question 21 months ago, created a question with more than 1,000 views. For looking for an R package for GO term analysis
Popular Question 23 months ago, created a question with more than 1,000 views. For looking for an R package for GO term analysis
Supporter 2.2 years ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1925 users visited in the last hour