User: Inquisitive8995

Reputation:
40
Status:
New User
Location:
Last seen:
2 weeks, 3 days ago
Joined:
1 year, 9 months ago
Email:
a*********@gmail.com

Posts by Inquisitive8995

<prev • 61 results • page 1 of 7 • next >
0
votes
0
answers
121
views
0
answers
Comment: C: Creation of separate sample sheet for demultiplexing
... Thank you for the reply. I will try this code and get back to you . ...
written 22 days ago by Inquisitive899540
0
votes
0
answers
121
views
0
answers
Comment: C: Creation of separate sample sheet for demultiplexing
... I will check those and try without mismatches also. Thank you so much ...
written 23 days ago by Inquisitive899540
0
votes
0
answers
121
views
0
answers
Comment: C: Creation of separate sample sheet for demultiplexing
... The default barcode mismatch of "1" is allowed ...
written 23 days ago by Inquisitive899540
0
votes
0
answers
121
views
0
answers
Comment: C: Creation of separate sample sheet for demultiplexing
... I am changing only the sample sheet and the output folder. Everything else is exactly the same ...
written 23 days ago by Inquisitive899540
1
vote
0
answers
121
views
0
answers
Creation of separate sample sheet for demultiplexing
... Hello, I have 6 samples for demultiplexing. I am using bcltofastq. When I created a sample sheet for these samples and demultiplexed them, one of the samples (say sample1) had very low number of reads (About 5k). But when I removed all other samples from the sample sheet and then redid the demulti ...
alignment samplesheet sequencing written 23 days ago by Inquisitive899540
3
votes
1
answer
129
views
1
answer
Common reads between two fastq files
... Hello, I have two fastq files which look something like this: File 1: >@SRR596683.96/1 TTGGGGGCTGTGACTGAAGAGAGTGACAGATCAATGAGCGAGTGGATGGCTAGCAGGAAGAACACGGGAGAGAGAA + :=<;1?)07? @SRR596683.238/1 CGAAAGCATCATAATCAGGAGTAAGACGAACATATGCCTTCTCTTTATTAGGTCAAATCATGGTGATGATCATTG ...
exome assembly sequence written 6 weeks ago by Inquisitive899540 • updated 6 weeks ago by finswimmer9.8k
1
vote
1
answer
167
views
1
answers
Answer: A: How to make small subset of large genotyping dataset with plink?
... Hello, If I am not wrong, you can use the --extract command in plink to do this. > To extract only a subset of SNPs, it is possible to specify a list of required SNPs and make a new file, or perform an analysis on this subset, by using the command plink --file data --extract mysnps.txt ...
written 3 months ago by Inquisitive899540
0
votes
2
answers
152
views
2
answers
Answer: A: Add string to a column of a file and retain the rest
... I think I answered my own question. It works when I use awk as given below: awk -v FS="\t" -v OFS="\t" '{print $1"/1",$2,$3,$4,$5,$6} inputfile.txt > output.txt ...
written 4 months ago by Inquisitive899540
0
votes
0
answers
211
views
0
answers
Comment: C: Exctracting genotype data on a single SNP from all individuals in a dataset
... Can you try and create a format similar to what 23andme uses? Like what is given below. `# rsid chromosome position genotype rs3094315 1 742429 AG rs12562034 1 758311 AG rs3934834 1 995669 CC` Then you can use plink to change that file to a ...
written 4 months ago by Inquisitive899540
0
votes
2
answers
152
views
2
answers
Comment: C: Add string to a column of a file and retain the rest
... Thanks for your reply. But this added the `\t` between column 1 and 2 but did not add "\1" ...
written 4 months ago by Inquisitive899540

Latest awards to Inquisitive8995

Supporter 5 months ago, voted at least 25 times.
Popular Question 6 months ago, created a question with more than 1,000 views. For Delete columns with specific headers in a dataframe in R
Popular Question 8 months ago, created a question with more than 1,000 views. For Delete columns with specific headers in a dataframe in R

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 792 users visited in the last hour