User: jjrin

gravatar for jjrin
jjrin10
Reputation:
10
Status:
New User
Location:
Last seen:
1 day, 11 hours ago
Joined:
8 months, 1 week ago
Email:
l********@yahoo.com

Posts by jjrin

<prev • 32 results • page 1 of 4 • next >
0
votes
0
answers
77
views
0
answers
Comment: C: R ggplot Align Y-Axis on multiple graphs
... Oh my you're right, I use the same username there and I thought I was posting there. Won't do that again. ...
written 1 day ago by jjrin10
1
vote
0
answers
77
views
0
answers
R ggplot Align Y-Axis on multiple graphs
... Hello I used ggarrange to create this plot, and I would like to align the y axis so that the y axis is the same throughout all graphs instead of being off center. Thank you. ![Misaligned y axis][1] [1]: https://image.ibb.co/k3s6YH/image.png ...
R ggplot2 ggarrange written 1 day ago by jjrin10 • updated 1 day ago by Kevin Blighe13k
0
votes
0
answers
101
views
0
answers
Can't make sva comparison despite very distinct batch effects
... I continuously receive this error when I try to run sva with my count data R code for sva: # Loading all variables library(sva) dat <- dds_matrix idx <- rowMeans(dat) > 1 dat <- dat[idx,] mod <- model.matrix(~batch, colData(dds)) mod0 <- model.mat ...
sva factors batch effect written 5 days ago by jjrin10
1
vote
0
answers
130
views
0
answers
Plotting a PCA Plot from SVASeq results
... Hello, I used SVASeq to remove batch effects in my data set. I have run SVASeq and gotten 8 surrogate variables and all of the covariates necessary for my conditions. How would I plot a more detailed PCA plot rather than the give plot svseq function that is used in the vignette? I am thinking of s ...
pca plot sva batch effects svaseq ruvseq written 21 days ago by jjrin10
0
votes
1
answer
285
views
1
answer
Using Mann-Whitney U Test to compare replicates
... Hello, I have several replicates of a certain variable (at least 5). I would like to compare these distributions to see how similar they are with each other. I have TPMs as a measurement as well as counts (if necessary). They are not normally distributed and I read that the Mann-Whitney U-Test is an ...
R rna-seq statistics written 3 months ago by jjrin10 • updated 3 months ago by Jean-Karim Heriche14k
1
vote
0
answers
219
views
0
answers
Salmon, Getting New TPM from new, updated NumReads
... Hello, I have recently normalized my read counts (NumReads in Salmon output) and I would like to get the new updated TPMs using these Numreads counts. Is there a method I could go around doing this? The effective length and length would be the same regardless. I have all of the same data available, ...
numreads alignment salmon written 3 months ago by jjrin10
0
votes
0
answers
254
views
0
answers
Comment: C: Salmon never completes, stuck on processing fragments
... Yes, it's fine for now, I have been running all of my programs with this many threads and i am currently not multithreading. ...
written 5 months ago by jjrin10
0
votes
0
answers
254
views
0
answers
Salmon never completes, stuck on processing fragments
... Hello I have been running salmon on some single-ended data. It runs fine initially and does process fragments, however it never actually completes. Here is my command history /usr/local/bin/Salmon-0.8.2_macOX_10.12/bin/salmon quant -p 24 -i /Volumes/RNA_SEQ/Reference_Genomes/Index/XENLA_JGIv1 ...
fastq salmon rna-seq written 5 months ago by jjrin10
0
votes
1
answer
484
views
1
answers
Comment: C: gffread error when extracting transcript sequences from gtf, coordinates exceed
... It works great, thank you so much! The fixed annotation looks good (you have to remove mtDNA but I was going to do that anyways) and running through gffread is seamless. Thanks again for the help! ...
written 6 months ago by jjrin10
0
votes
1
answer
484
views
1
answers
Comment: C: gffread error when extracting transcript sequences from gtf, coordinates exceed
... My fasta file looks like this: >Scaffold100 gttcaaactttcataacctgccaaattttgtaaaatgaacatggtgtggccacaaaaatggtcgtggtcaaaaaattcac tgcgcgcaagtttttttgtccctctttttatttccaaaatgttgggaggtATttagacatttcacatttatattctcata taccacactttccacattacacaATCTTCAGCCACCTTATAAATGGAACCTGCCGGTGCTACTGCTTTACATTG ...
written 7 months ago by jjrin10

Latest awards to jjrin

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1159 users visited in the last hour