User: jjrin

gravatar for jjrin
jjrin10
Reputation:
10
Status:
New User
Location:
Last seen:
1 week, 2 days ago
Joined:
5 months, 1 week ago
Email:
l********@yahoo.com

Posts by jjrin

<prev • 28 results • page 1 of 3 • next >
0
votes
1
answer
150
views
1
answer
Using Mann-Whitney U Test to compare replicates
... Hello, I have several replicates of a certain variable (at least 5). I would like to compare these distributions to see how similar they are with each other. I have TPMs as a measurement as well as counts (if necessary). They are not normally distributed and I read that the Mann-Whitney U-Test is an ...
R rna-seq statistics written 14 days ago by jjrin10 • updated 14 days ago by Jean-Karim Heriche13k
1
vote
0
answers
119
views
0
answers
Salmon, Getting New TPM from new, updated NumReads
... Hello, I have recently normalized my read counts (NumReads in Salmon output) and I would like to get the new updated TPMs using these Numreads counts. Is there a method I could go around doing this? The effective length and length would be the same regardless. I have all of the same data available, ...
numreads alignment salmon written 17 days ago by jjrin10
0
votes
0
answers
186
views
0
answers
Comment: C: Salmon never completes, stuck on processing fragments
... Yes, it's fine for now, I have been running all of my programs with this many threads and i am currently not multithreading. ...
written 10 weeks ago by jjrin10
0
votes
0
answers
186
views
0
answers
Salmon never completes, stuck on processing fragments
... Hello I have been running salmon on some single-ended data. It runs fine initially and does process fragments, however it never actually completes. Here is my command history /usr/local/bin/Salmon-0.8.2_macOX_10.12/bin/salmon quant -p 24 -i /Volumes/RNA_SEQ/Reference_Genomes/Index/XENLA_JGIv1 ...
fastq salmon rna-seq written 10 weeks ago by jjrin10
0
votes
1
answer
313
views
1
answers
Comment: C: gffread error when extracting transcript sequences from gtf, coordinates exceed
... It works great, thank you so much! The fixed annotation looks good (you have to remove mtDNA but I was going to do that anyways) and running through gffread is seamless. Thanks again for the help! ...
written 3 months ago by jjrin10
0
votes
1
answer
313
views
1
answers
Comment: C: gffread error when extracting transcript sequences from gtf, coordinates exceed
... My fasta file looks like this: >Scaffold100 gttcaaactttcataacctgccaaattttgtaaaatgaacatggtgtggccacaaaaatggtcgtggtcaaaaaattcac tgcgcgcaagtttttttgtccctctttttatttccaaaatgttgggaggtATttagacatttcacatttatattctcata taccacactttccacattacacaATCTTCAGCCACCTTATAAATGGAACCTGCCGGTGCTACTGCTTTACATTG ...
written 4 months ago by jjrin10
0
votes
1
answer
313
views
1
answers
Comment: C: gffread error when extracting transcript sequences from gtf, coordinates exceed
... Thank you so much for this. I tried to run it but I get a key error which is probably due to my gtf file. Traceback (most recent call last): File "/Users/margaretsaha/Desktop/gtf_fixer_to_gffread.py", line 23, in transcript_size = int(transcript[header]) KeyError: 'Scaffold10 ...
written 4 months ago by jjrin10
3
votes
1
answer
313
views
1
answer
gffread error when extracting transcript sequences from gtf, coordinates exceed sequence length
... Hello, I am trying to extract some transcript sequences from a stringtie merged gtf using gffread and am getting the following errors: Error (GFaSeqGet): subsequence cannot be larger than 227 Error getting subseq for MSTRG.17.1 (1..229)! This error happens for many of gene entries, some bu ...
rnaseq stringtie cufflinks gffread transcript written 4 months ago by jjrin10 • updated 4 months ago by victor.gambarini30
0
votes
0
answers
241
views
0
answers
Comment: C: Lots of antisense transcripts in my annotation?
... I believe that I assembled it correctly since I used the --rf or that I have a stranded library fr-firststrand in my alignment software (StringTie). When using htseq to retrieve counts I also put in paired end and reverse to account for the directionality. But my data matches up with the database we ...
written 4 months ago by jjrin10
4
votes
0
answers
241
views
0
answers
Lots of antisense transcripts in my annotation?
... Hello, I recently made a new annotation using a well known annotation from a paper (Sessions) and another from a well known database (Xenbase/Taejoon Lab). I used Stringtie to organize the transcriptome and I have found many unusual transcripts. In the new annotation, most of the transcripts are no ...
annotation antisense transcripts written 4 months ago by jjrin10

Latest awards to jjrin

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 604 users visited in the last hour