User: somitmittal

gravatar for somitmittal
Reputation:
0
Status:
New User
Last seen:
1 year ago
Joined:
1 year ago
Email:
s**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by somitmittal

<prev • 4 results • page 1 of 1 • next >
0
votes
0
answers
569
views
0
answers
Best ORF to choose
... If a gene sequence gives us multiple ORF's of varying lengths then what should be the criteria for choosing the best ORF for calculating various values like CAI,CBI etc. ...
orf codon rna-seq dna written 12 months ago by somitmittal0
0
votes
0
answers
357
views
0
answers
Multiple ORF's of same length
... If we have multiple ORF's with the same length in case of bacillus subtilis 168.Then What is the criteria for selection of the best ORF among them? ...
dnaseq codon rna-seq orf written 12 months ago by somitmittal0
0
votes
1
answer
458
views
1
answers
Comment: C: Does not begin with a recognised start codon
... >DNEG10010082 TTGATAGGGCAGAAAGCTTGGGTGAACATTGGCAAGACCGAATTCATCTTGCTTCTTGTC GTTGGAATTTTAACCATCATCAATGTACTAACAGCAGACGGAGAAAAGCGTACATTTCAT TCTCCTAAGAAAAAGAATATCAATCATTTAACCCTTTATGATTGCGTATCTCCGGAAGTT CAGAACAGTATAAACGAAACAGGGCGTGTGACAAACTTCTTTTGA > DNEG10010083 ...
written 12 months ago by somitmittal0 • updated 12 months ago by Istvan Albert ♦♦ 77k
1
vote
1
answer
458
views
1
answer
Does not begin with a recognised start codon
... The problem I am facing is that I am getting errors like Warning: Sequence 280 "DNEG10010009 " does not begin with a recognised start codon. Warning: Sequence 280 "DNEG10010009 " has 16 internal stop codon(s) The input I have provided is a sequence of Nucleotide sequences for each in ...
gene codon sequence codon adaptation index codonw written 13 months ago by somitmittal0 • updated 12 months ago by Istvan Albert ♦♦ 77k

Latest awards to somitmittal

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 706 users visited in the last hour