User: Sharon

gravatar for Sharon
Sharon340
Reputation:
340
Status:
Trusted
Location:
Last seen:
1 week, 5 days ago
Joined:
1 year, 3 months ago
Email:
s***********@gmail.com

Posts by Sharon

<prev • 208 results • page 1 of 21 • next >
2
votes
1
answer
321
views
1
answer
Do genes starting with Gm have a canonical name yet?
... Hi everyone Do you know if the genes starting with Gm in **mouse** have a canonical name or not? I am stuck with those when I used gencode transcripts and gencode gtf for annotations too. My understanding is they don't have a canonical name yet. But some of them is mentioned to have overlap with ...
rna-seq written 4 months ago by Sharon340 • updated 4 months ago by Emily_Ensembl16k
0
votes
1
answer
157
views
1
answers
Comment: C: Validate interesting gene from a burden test and association studies (SkatO, etc
... Thanks WouterDeCoster :) ...
written 4 months ago by Sharon340
4
votes
1
answer
157
views
1
answer
Validate interesting gene from a burden test and association studies (SkatO, etc)
... Hi Everyone If we test the cummulative effect of a group of variants in a gene (or a region) using burden test and association analysis stuff. If a gene is found very significant, should we validate all variants in the gene using sanger sequence? Doesn't seem reasonable, so what we can do to prove ...
skat association burden snp validation written 4 months ago by Sharon340 • updated 4 months ago by WouterDeCoster33k
1
vote
1
answer
410
views
1
answers
Comment: C: How tximport work with gencode transcripts?
... work doesn't leave me =D I just switched to something else :) :) ...
written 4 months ago by Sharon340
0
votes
1
answer
410
views
1
answers
Comment: C: How tximport work with gencode transcripts?
... Hi Kevin Thanks so much and sorry for the late reply, was away. Yes, this makes sense. I understand where the problem came from but did not how to solve, am still learning R. I will try that. Thanks so much :) ...
written 4 months ago by Sharon340
5
votes
1
answer
410
views
1
answer
How tximport work with gencode transcripts?
... Hi All How to use tximport with gencode? I used Gencode transcripts for mouse looks like this: >ENSMUST00000193812.1|ENSMUSG00000102693.1|OTTMUSG00000049935.1|OTTMUST00000127109.1|RP23-271O17.1-001|RP23-271O17.1|1070|TEC| AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAA ...
R rna-seq written 4 months ago by Sharon340 • updated 4 months ago by Kevin Blighe31k
0
votes
1
answer
251
views
1
answers
Answer: A: Checking steps to analyze snp-array data for variants detection
... Just in case some one is new to SNP array like me, I found this tutorial, and it is interesting and very helpful: https://onlinelibrary.wiley.com/doi/full/10.1002/sim.6605 ...
written 5 months ago by Sharon340
0
votes
1
answer
251
views
1
answer
Checking steps to analyze snp-array data for variants detection
... Hi everyone I would like to double check my naive steps to analyze SNP-Array data to detect variants associated with a specific phenotypes with you. It is my first go with this data. 1. I converted illumina report to plink format using genome studio. 2. Then I converted plink format to vcf. 3. ...
snp-array snp written 5 months ago by Sharon340
0
votes
0
answers
136
views
0
answers
Can we detect or guess or estimate phenocopies computationally?
... Hi Everyone Is there a way to detect phenocopies -computationally-, like could linkage analysis help or any other method I am oblivious of? We have an interesting variant x segregating in all affected from gene G. But for one patient we have variant y from the same gene but not x. I was thinking i ...
exome data written 5 months ago by Sharon340
0
votes
0
answers
269
views
0
answers
Comment: C: How to present/evaluate RNAseq deconvolution results?
... Thanks genomax. I also took a look to those posts but still not clear though :( ...
written 5 months ago by Sharon340

Latest awards to Sharon

Popular Question 5 weeks ago, created a question with more than 1,000 views. For Heatmap for differential gene expressions
Popular Question 10 weeks ago, created a question with more than 1,000 views. For Kinship Relatedness using plink
Popular Question 3 months ago, created a question with more than 1,000 views. For Kinship Relatedness using plink
Scholar 5 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: Coverage in whole genome sequencing
Voter 8 months ago, voted more than 100 times.
Scholar 11 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Centurion 11 months ago, created 100 posts.
Scholar 11 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Scholar 11 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Scholar 11 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Scholar 11 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Supporter 12 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1202 users visited in the last hour