User: Sharon

gravatar for Sharon
Sharon340
Reputation:
340
Status:
Trusted
Location:
Last seen:
1 day, 13 hours ago
Joined:
12 months ago
Email:
s***********@gmail.com

Posts by Sharon

<prev • 208 results • page 1 of 21 • next >
2
votes
1
answer
76
views
1
answer
Do genes starting with Gm have a canonical name yet?
... Hi everyone Do you know if the genes starting with Gm in **mouse** have a canonical name or not? I am stuck with those when I used gencode transcripts and gencode gtf for annotations too. My understanding is they don't have a canonical name yet. But some of them is mentioned to have overlap with ...
rna-seq written 4 days ago by Sharon340 • updated 4 days ago by Emily_Ensembl15k
0
votes
1
answer
60
views
1
answers
Comment: C: Validate interesting gene from a burden test and association studies (SkatO, etc
... Thanks WouterDeCoster :) ...
written 11 days ago by Sharon340
4
votes
1
answer
60
views
1
answer
Validate interesting gene from a burden test and association studies (SkatO, etc)
... Hi Everyone If we test the cummulative effect of a group of variants in a gene (or a region) using burden test and association analysis stuff. If a gene is found very significant, should we validate all variants in the gene using sanger sequence? Doesn't seem reasonable, so what we can do to prove ...
skat association burden snp validation written 11 days ago by Sharon340 • updated 11 days ago by WouterDeCoster30k
1
vote
1
answer
128
views
1
answers
Comment: C: How tximport work with gencode transcripts?
... work doesn't leave me =D I just switched to something else :) :) ...
written 22 days ago by Sharon340
0
votes
1
answer
128
views
1
answers
Comment: C: How tximport work with gencode transcripts?
... Hi Kevin Thanks so much and sorry for the late reply, was away. Yes, this makes sense. I understand where the problem came from but did not how to solve, am still learning R. I will try that. Thanks so much :) ...
written 22 days ago by Sharon340
5
votes
1
answer
128
views
1
answer
How tximport work with gencode transcripts?
... Hi All How to use tximport with gencode? I used Gencode transcripts for mouse looks like this: >ENSMUST00000193812.1|ENSMUSG00000102693.1|OTTMUSG00000049935.1|OTTMUST00000127109.1|RP23-271O17.1-001|RP23-271O17.1|1070|TEC| AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAA ...
R rna-seq written 23 days ago by Sharon340 • updated 23 days ago by Kevin Blighe23k
0
votes
1
answer
128
views
1
answers
Answer: A: Checking steps to analyze snp-array data for variants detection
... Just in case some one is new to SNP array like me, I found this tutorial, and it is interesting and very helpful: https://onlinelibrary.wiley.com/doi/full/10.1002/sim.6605 ...
written 4 weeks ago by Sharon340
0
votes
1
answer
128
views
1
answer
Checking steps to analyze snp-array data for variants detection
... Hi everyone I would like to double check my naive steps to analyze SNP-Array data to detect variants associated with a specific phenotypes with you. It is my first go with this data. 1. I converted illumina report to plink format using genome studio. 2. Then I converted plink format to vcf. 3. ...
snp-array snp written 5 weeks ago by Sharon340
0
votes
0
answers
91
views
0
answers
Can we detect or guess or estimate phenocopies computationally?
... Hi Everyone Is there a way to detect phenocopies -computationally-, like could linkage analysis help or any other method I am oblivious of? We have an interesting variant x segregating in all affected from gene G. But for one patient we have variant y from the same gene but not x. I was thinking i ...
exome data written 6 weeks ago by Sharon340
0
votes
0
answers
103
views
0
answers
Comment: C: How to present/evaluate RNAseq deconvolution results?
... Thanks genomax. I also took a look to those posts but still not clear though :( ...
written 6 weeks ago by Sharon340

Latest awards to Sharon

Scholar 7 weeks ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Teacher 7 weeks ago, created an answer with at least 3 up-votes. For A: Coverage in whole genome sequencing
Voter 4 months ago, voted more than 100 times.
Scholar 7 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Centurion 7 months ago, created 100 posts.
Scholar 7 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Scholar 7 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Scholar 7 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Scholar 7 months ago, created an answer that has been accepted. For A: Alignment dropped with Salmon
Supporter 8 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 781 users visited in the last hour