User: 11yj3312

gravatar for 11yj3312
11yj33120
Reputation:
0
Status:
New User
Last seen:
1 month ago
Joined:
1 year, 2 months ago
Email:
1*******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by 11yj3312

<prev • 8 results • page 1 of 1 • next >
0
votes
0
answers
148
views
0
answers
The quality of intermediate base of read is not good.
... Hi I have some RANseq data. When I use fastQC to do quality control,The results are as follows: ![enter image description here][1] ![enter image description here][2] [1]: https://note.youdao.com/yws/public/resource/e53c7af7b1eeaaf3a96e859dc00dc089/xmlnote/0967AE22A0584B0998ACA74FDB5D7448/4338 ...
rnaseq quality control fastqqc written 5 weeks ago by 11yj33120
0
votes
0
answers
365
views
0
answers
Crispr-cas9 screen analysis mageck
... Hi friends! Now I have a batch of paired-end sequencing data,I don't know whether mageck can handle paired-end sequencing data,I don't find appropriate parameters.What do you do with paired-end sequencing data? I try just use R1 sequencing data mapped with sgRNA library,but only about 60% reads can ...
crispr-cas9 mageck sequencing written 8 months ago by 11yj33120 • updated 6 months ago by Biostar ♦♦ 20
0
votes
2
answers
699
views
2
answers
Question: From A List Of Gene Symbols To A Bed File With name of the chromosome and Start/end position
... Hi,y'all, I have a list of Gene Symbols,How can i transform Gene Symbols to a .bed file with name of the chromosome and Start/end position ...
gene genesymbols position bed chromosome written 10 months ago by 11yj33120 • updated 10 months ago by Alex Reynolds26k
1
vote
0
answers
339
views
0
answers
crispr mageck analysis ,Sam library
... Dear all, I download SAM Library from website,but there is only guide sequence and gene-number,like this: NM_000014_1 AAGTGAGCTCTTACGGGAAT NM_000014 NM_000014_2 GAATGTAGTTTTAGCCCTCC NM_000014 NM_000014_3 GGGATTCTATTTAGCCCGCC NM_000014 how can i kown the gene_id of ea ...
genome crispr sam library written 11 months ago by 11yj33120 • updated 11 months ago by Pierre Lindenbaum114k
0
votes
0
answers
693
views
0
answers
Comment: C: Question: Error HISAT2 output for HTseq-count
... I have tried the latest htseq-count,No previous error occurred.Think you! ...
written 11 months ago by 11yj33120
0
votes
0
answers
693
views
0
answers
Comment: C: Question: Error HISAT2 output for HTseq-count
... Think you !I will try it ...
written 11 months ago by 11yj33120
0
votes
0
answers
693
views
0
answers
Question: Error HISAT2 output for HTseq-count
... Dear all, I am analyzing paired-end stranded RNAseq data . I would be interested in using HISAT2 for the alignment, and HTseq-count to count the features of the aligned reads. When I used HTseq-count to count the reads: htseq-count -r pos -f bam SRR3589957_sorted.bam ../reference/gencode.v26lift37. ...
software error alignment rna-seq written 11 months ago by 11yj33120
0
votes
0
answers
401
views
0
answers
Mageck pathway command
... I obtain a pathway summary by using mageck pathway command,as follows: id num neg|score neg|p-value neg|fdr neg|rank neg|goodsgrna pos|score pos|p-value pos|fdr pos|rank pos|goodsgrna KEGG_RIBOSOME 87 8.3272e-23 2.6473e-05 0.001238 1 50 0 ...
software error gene sequence written 14 months ago by 11yj33120

Latest awards to 11yj3312

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1754 users visited in the last hour