User: 11yj3312

gravatar for 11yj3312
11yj33120
Reputation:
0
Status:
New User
Last seen:
6 months, 3 weeks ago
Joined:
2 years, 11 months ago
Email:
1*******@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by 11yj3312

<prev • 9 results • page 1 of 1 • next >
0
votes
0
answers
345
views
0
answers
GATK4,Cann't get right CalculateContamination result
... Question regarding CalculateContamination(GATK/4.1.2.0): With CalculateContamination in tumor matched mode, I get: contamination error NaN 1.0 When I look at the tumor.table and normal. table files generated by Getpileupsummaries, I don't see any unusual data structure/value What can be the probl ...
gatk4 somatic mutation written 14 months ago by 11yj33120
0
votes
0
answers
441
views
0
answers
The quality of intermediate base of read is not good.
... Hi I have some RANseq data. When I use fastQC to do quality control,The results are as follows: ![enter image description here][1] ![enter image description here][2] [1]: https://note.youdao.com/yws/public/resource/e53c7af7b1eeaaf3a96e859dc00dc089/xmlnote/0967AE22A0584B0998ACA74FDB5D7448/4338 ...
rnaseq quality control fastqqc written 22 months ago by 11yj33120
4
votes
1
answer
1.2k
views
1
answer
Crispr-cas9 screen analysis mageck
... Hi friends! Now I have a batch of paired-end sequencing data,I don't know whether mageck can handle paired-end sequencing data,I don't find appropriate parameters.What do you do with paired-end sequencing data? I try just use R1 sequencing data mapped with sgRNA library,but only about 60% reads can ...
crispr-cas9 mageck sequencing written 2.4 years ago by 11yj33120 • updated 8 months ago by dsull1.5k
0
votes
2
answers
1.3k
views
2
answers
Question: From A List Of Gene Symbols To A Bed File With name of the chromosome and Start/end position
... Hi,y'all, I have a list of Gene Symbols,How can i transform Gene Symbols to a .bed file with name of the chromosome and Start/end position ...
gene genesymbols position bed chromosome written 2.6 years ago by 11yj33120 • updated 2.6 years ago by Alex Reynolds30k
1
vote
0
answers
689
views
0
answers
crispr mageck analysis ,Sam library
... Dear all, I download SAM Library from website,but there is only guide sequence and gene-number,like this: NM_000014_1 AAGTGAGCTCTTACGGGAAT NM_000014 NM_000014_2 GAATGTAGTTTTAGCCCTCC NM_000014 NM_000014_3 GGGATTCTATTTAGCCCGCC NM_000014 how can i kown the gene_id of ea ...
genome crispr sam library written 2.7 years ago by 11yj33120 • updated 2.7 years ago by Pierre Lindenbaum129k
0
votes
0
answers
1.4k
views
0
answers
Comment: C: Question: Error HISAT2 output for HTseq-count
... I have tried the latest htseq-count,No previous error occurred.Think you! ...
written 2.7 years ago by 11yj33120
0
votes
0
answers
1.4k
views
0
answers
Comment: C: Question: Error HISAT2 output for HTseq-count
... Think you !I will try it ...
written 2.7 years ago by 11yj33120
0
votes
0
answers
1.4k
views
0
answers
Question: Error HISAT2 output for HTseq-count
... Dear all, I am analyzing paired-end stranded RNAseq data . I would be interested in using HISAT2 for the alignment, and HTseq-count to count the features of the aligned reads. When I used HTseq-count to count the reads: htseq-count -r pos -f bam SRR3589957_sorted.bam ../reference/gencode.v26lift37. ...
software error alignment rna-seq written 2.7 years ago by 11yj33120
0
votes
0
answers
791
views
0
answers
Mageck pathway command
... I obtain a pathway summary by using mageck pathway command,as follows: id num neg|score neg|p-value neg|fdr neg|rank neg|goodsgrna pos|score pos|p-value pos|fdr pos|rank pos|goodsgrna KEGG_RIBOSOME 87 8.3272e-23 2.6473e-05 0.001238 1 50 0 ...
software error gene sequence written 2.9 years ago by 11yj33120

Latest awards to 11yj3312


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 929 users visited in the last hour