User: Harumi

gravatar for Harumi
New User
Last seen:
6 hours ago
1 year ago

Posts by Harumi

<prev • 6 results • page 1 of 1 • next >
Is it ok to use DREME to predict motifs from RNA-Seq data?
... Is it ok to use DREME to predict motifs from RNA-Seq data? I saw that DREME is used to predict motifs from large datasets provided by CHIP-Seq experiments, however I have some diferentially expressed genes from RNA-Seq data that I want to understand regulation by motif prediction. I ran MEME analys ...
dreme rna-seq motif finding written 7 hours ago by Harumi10
Comment: C: Remove text and keep '> + ID' in fasta file
... It worked! Thank you very much for your helpful explanation! I am still a beginner in bioinformatics ...
written 6 months ago by Harumi10
Comment: C: Remove text and keep '> + ID' in fasta file
... It worked! Thank you for your help! ...
written 6 months ago by Harumi10
Comment: C: Remove text and keep '> + ID' in fasta file
... It worked! Thank you for your help! ...
written 6 months ago by Harumi10
Comment: C: Remove text and keep '> + ID' in fasta file
... Thank you for your help! I tried: sed 's/.*__[\+-]__/>/' | sed 's/__.*//' input.fa > output.fa But it took a long time processing so I canceled. When I tried: sed 's/.*__[\+-]__/>/' input.fa > output.fa | sed 's/__.*//' output.fa > output2.fa The output was empty. Why ...
written 6 months ago by Harumi10
7 follow
Remove text and keep '> + ID' in fasta file
... Hello, I have multiple fasta sequences that are like this: >2p__scaffold_2__5799__6580__-__778568__0.00__0.00 GCTGGCGACGGATCTAGGCTCAGCGCAGAAGCAACTGAGAGTCGGCGATGAGCAGCCGGA GCTGGCGACGGATCTAGGCTCAGCGCAGAAGCAA >2p__scaffold_2__5799__6580__+__778569__0.00__0.00 GCTGGCGACG ...
fasta sed written 6 months ago by Harumi10 • updated 6 months ago by Alex Reynolds25k

Latest awards to Harumi

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 837 users visited in the last hour