User: Harumi

gravatar for Harumi
Harumi10
Reputation:
10
Status:
New User
Location:
Brazil
Last seen:
2 months, 4 weeks ago
Joined:
9 months, 3 weeks ago
Email:
l****************@hotmail.com

Posts by Harumi

<prev • 5 results • page 1 of 1 • next >
0
votes
3
answers
288
views
3
answers
Comment: C: Remove text and keep '> + ID' in fasta file
... It worked! Thank you very much for your helpful explanation! I am still a beginner in bioinformatics ...
written 3 months ago by Harumi10
0
votes
3
answers
288
views
3
answers
Comment: C: Remove text and keep '> + ID' in fasta file
... It worked! Thank you for your help! ...
written 3 months ago by Harumi10
0
votes
3
answers
288
views
3
answers
Comment: C: Remove text and keep '> + ID' in fasta file
... It worked! Thank you for your help! ...
written 3 months ago by Harumi10
0
votes
3
answers
288
views
3
answers
Comment: C: Remove text and keep '> + ID' in fasta file
... Thank you for your help! I tried: sed 's/.*__[\+-]__/>/' | sed 's/__.*//' input.fa > output.fa But it took a long time processing so I canceled. When I tried: sed 's/.*__[\+-]__/>/' input.fa > output.fa | sed 's/__.*//' output.fa > output2.fa The output was empty. Why ...
written 3 months ago by Harumi10
16
votes
3
answers
288
views
6 follow
3
answers
Remove text and keep '> + ID' in fasta file
... Hello, I have multiple fasta sequences that are like this: >2p__scaffold_2__5799__6580__-__778568__0.00__0.00 GCTGGCGACGGATCTAGGCTCAGCGCAGAAGCAACTGAGAGTCGGCGATGAGCAGCCGGA GCTGGCGACGGATCTAGGCTCAGCGCAGAAGCAA >2p__scaffold_2__5799__6580__+__778569__0.00__0.00 GCTGGCGACG ...
fasta sed written 3 months ago by Harumi10 • updated 3 months ago by Alex Reynolds24k

Latest awards to Harumi

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1487 users visited in the last hour