User: Ambika

gravatar for Ambika
Ambika30
Reputation:
30
Status:
New User
Location:
United States
Last seen:
6 days, 15 hours ago
Joined:
2 years, 8 months ago
Email:
a***************@gmail.com

Posts by Ambika

<prev • 106 results • page 2 of 11 • next >
0
votes
1
answer
143
views
1
answer
Interpreting co-ordinates file
... Hello everyone, I got the coordinate file after aligning my query genome file to the reference genome file using MUMmer. Now I want to distinguish core and accessory genome using that coordinate file. But I do not know how I can do that. The coordinate file looks like this: [S1] [E ...
genome alignment written 6 months ago by Ambika30 • updated 6 months ago by Mensur Dlakic5.4k
0
votes
0
answers
237
views
0
answers
Mummer for running multiple query files
... Hello everyone, I am trying to use Mummer to differentiate core and accessory chromosomes in some genome assembly files I have. I used the following code to align single query file to the single reference file which seems to work fine. nucmer -maxmatch -c 100 -p Fop Fol_fasta Fusox.fasta ...
assembly mummer alignment nucmer written 6 months ago by Ambika30
0
votes
1
answer
500
views
1
answers
Comment: C: how to download cazy database
... @Dattatray I was following the link on their paper. I did not know they moved it. Now it works. Thanks a lot. ...
written 10 months ago by Ambika30
3
votes
1
answer
500
views
1
answer
how to download cazy database
... Hey Biostars, I am trying to download [Cazy][1] database, but I could not find a place where I can download. I also tried another program [dbcan][2] but the site they provided does not seem to open. Thank you, Ambika [1]: http://www.cazy.org/ [2]: http://cys.bios.niu.edu/dbCAN2 ...
database cazymes written 10 months ago by Ambika30 • updated 10 months ago by Dattatray Mongad350
0
votes
4
answers
375
views
4
answers
Comment: C: Remove double vertical bar "||" at the end of the sequence in a fasta file
... Thanks you so much it works. ...
written 11 months ago by Ambika30
21
votes
4
answers
375
views
7 follow
4
answers
Remove double vertical bar "||" at the end of the sequence in a fasta file
... Hello I have a fasta file as >jgi|FusspF23_1|104542 GGTTCTCTTGTCTGTTTTTAAAAGAGTCTCGAGACCCC|| >jgi|FusspF23_1|10121 GGGGCCGCCCTCGATTCATCAGCGAAATTGCTCAGTCGGGCG|| at the end of fasta sequence I have these symbols `"||"` which I want to remove. I tried using *sed* but in that wa ...
fasta sed awk written 11 months ago by Ambika30 • updated 11 months ago by SMK1.9k
0
votes
0
answers
287
views
0
answers
Comment: C: Parsing a fasta file
... I think I figure it out with the sed command. I just replaced the space that I had with that output.fa file with a line using this code. sed 's/\t/\n/g' output.fa> output1.fa >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCTCACTCTTCGAGGCCAACCGCAATGTGACTGATCCGAGACACCAAAGAGCT ...
written 11 months ago by Ambika30
0
votes
0
answers
287
views
0
answers
Comment: C: Parsing a fasta file
... I tried this awk command awk '/^>/ {printf("%s%s\t",(N>0?"\n":""),$0);N++;next;} {printf("%s",$0);} END {printf("\n");}' < input_best_transcripts.fasta > output.fa It gives me the fasta file with single line >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCT ...
written 11 months ago by Ambika30
0
votes
0
answers
287
views
0
answers
Parsing a fasta file
... Hello everyone, I have a fasta file like this in multiple lines >jgi|Necha2|9923|gw1.3.792.1 CGTGGCCAGGCTCTTTATATTCGCTCACTCTTCGAGGCCAACCGCAATGTGACTGATCCGAGACACCAAA GAGCTCTGTTGACGGAGACAGAGAAGCTACTGGAGAGCTGGAAGCACCCCGATCCCTACACGCCCCCGAC TGCTCCCGGAGGCTCAAAGTTCGAGCGAAACCTGCCATCG ...
assembly sequence written 11 months ago by Ambika30
0
votes
0
answers
1.3k
views
0
answers
Comment: C: qPCR: Huge variation in fold change of genes between biological replicates
... @Kevin I am just using cDNA to amplify the genes. I did not apply any whole genome amplification ...
written 23 months ago by Ambika30

Latest awards to Ambika

Centurion 10 days ago, created 100 posts.
Popular Question 5 weeks ago, created a question with more than 1,000 views. For Cuffmerge error while merging gtf files
Great Question 6 weeks ago, created a question with more than 5,000 views. For Feature Counts output interpretation
Great Question 6 months ago, created a question with more than 5,000 views. For Unable to access jarfile trimmomatic-0.35
Popular Question 6 months ago, created a question with more than 1,000 views. For Interpretation of Results from trimmomatic
Popular Question 6 months ago, created a question with more than 1,000 views. For HTseq Pysam error
Popular Question 6 months ago, created a question with more than 1,000 views. For stranded vs not stranded Htseq-output differences
Popular Question 6 months ago, created a question with more than 1,000 views. For HTseq error: Too few arguements
Popular Question 10 months ago, created a question with more than 1,000 views. For Cufflinks gtf file to htseq
Popular Question 10 months ago, created a question with more than 1,000 views. For DESeq2 workflow for RNAseq
Supporter 10 months ago, voted at least 25 times.
Popular Question 23 months ago, created a question with more than 1,000 views. For Deseq2 library load error
Popular Question 23 months ago, created a question with more than 1,000 views. For Unable to access jarfile trimmomatic-0.35
Popular Question 23 months ago, created a question with more than 1,000 views. For HTseq Pysam error
Popular Question 23 months ago, created a question with more than 1,000 views. For Trimmomatic jar file
Popular Question 23 months ago, created a question with more than 1,000 views. For Interpretation of Results from trimmomatic
Popular Question 23 months ago, created a question with more than 1,000 views. For HTseq error: Too few arguements
Popular Question 23 months ago, created a question with more than 1,000 views. For DESeq2 workflow for RNAseq
Popular Question 23 months ago, created a question with more than 1,000 views. For Feature Counts output interpretation
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Unable to access jarfile trimmomatic-0.35
Rising Star 2.5 years ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 777 users visited in the last hour