User: gb

gravatar for gb
gb440
Reputation:
440
Status:
Trusted
Location:
Last seen:
18 hours ago
Joined:
1 year, 1 month ago
Email:
m**************@gmail.com

Posts by gb

<prev • 88 results • page 1 of 9 • next >
0
votes
1
answer
103
views
1
answers
Comment: C: Aligning multiple species for primer
... 1)Maybe something with K-mers is an option 2)With k-mers any computer A k-mer tool: http://www.genome.umd.edu/jellyfish.html ...
written 3 days ago by gb440
1
vote
0
answers
63
views
0
answers
Comment: C: Small DNA-seq read files for tests
... You can just search for lets say "e.coli" on the SRA page right? https://www.ncbi.nlm.nih.gov/sra https://www.ncbi.nlm.nih.gov/sra/?term=e.coli EDIT: On the left of the page you can select some options like "DNA" and "Genome". Maybe you can use a mitogenome for your testing. https://www.ncbi.nl ...
written 4 days ago by gb440
0
votes
1
answer
110
views
1
answers
Comment: C: Reference gene identification for contig ordering, when sample species is unknow
... Just to test or to try to find those genes it does not matter if you choose data from a single microorganism or multiple microorganism (metagenome). It helps if you know upfront that the organism has shown antimicrobial resistance in other studies. Globally: 1. download the raw fastq files 2. Do ...
written 10 days ago by gb440
0
votes
1
answer
69
views
1
answers
Answer: A: Makeblast error when Nucleotide sequence contanis 'X" character
... You can change the X to a N with something like this: sed -i '/^>/! s/X/N/g' inputfasta.fa ...
written 10 days ago by gb440
0
votes
1
answer
220
views
1
answers
Comment: C: Missing sequences in local NT database
... Thanks! something learned again ...
written 10 days ago by gb440
0
votes
1
answer
220
views
1
answers
Comment: C: Missing sequences in local NT database
... I actually did it this way but noticed that if I execute the following command: blastdbcmd -db nt -entry all > nt.fa Sometimes a sequence got two headers in nt.fa like this: >accession|header1>accession|header2 AGTAGATAGAGAGACGACACTAGCATCA Maybe the command is wrong... I do ...
written 10 days ago by gb440
0
votes
0
answers
65
views
0
answers
Comment: C: primers for whole metagenome
... This is just shotgun sequencing right? So no use of PCR ...
written 11 days ago by gb440
0
votes
1
answer
110
views
1
answers
Comment: C: Reference gene identification for contig ordering, when sample species is unknow
... Depends on what your goal is I think. But if it is only human and E.coli you could use human and E.coli. You could also only use E.coli if you are not interested in the human genes. I personally think that if the goal is to find antimicrobial resistane genes you dont have to worry to much about huma ...
written 11 days ago by gb440
0
votes
1
answer
110
views
1
answers
Answer: A: Reference gene identification for contig ordering, when sample species is unknow
... I checked ERR209055 and it is a human gut metagenome. So it is a mix of a lot of different species, and therefore you can not choose a reference. Why do you need to order the contigs? After assembly you need to predict the open reading frames and blast it against a antimicrobial resistance gene data ...
written 12 days ago by gb440
0
votes
1
answer
119
views
1
answers
Comment: C: Why are GC% per base important in quality control of reads?
... I also believe that there is a rule that you should mention that it is about a school assignment. Maybe a moderator can confirm that. ...
written 13 days ago by gb440

Latest awards to gb

Appreciated 17 days ago, created a post with more than 5 votes. For A: Removing Duplicates before aligning
Teacher 17 days ago, created an answer with at least 3 up-votes. For A: Removing Duplicates before aligning
Commentator 17 days ago, created a comment with at least 3 up-votes. For C: How much I must feel useless?
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: Removing Duplicates before aligning
Scholar 10 weeks ago, created an answer that has been accepted. For A: Clustering of metabarcoding reads from many environmental samples
Appreciated 3 months ago, created a post with more than 5 votes. For A: Removing Duplicates before aligning
Scholar 3 months ago, created an answer that has been accepted. For A: Clustering of metabarcoding reads from many environmental samples
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: Removing Duplicates before aligning
Scholar 8 months ago, created an answer that has been accepted. For A: Clustering of metabarcoding reads from many environmental samples

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1016 users visited in the last hour