User: horsedog

gravatar for horsedog
horsedog20
Reputation:
20
Status:
New User
Location:
Last seen:
19 hours ago
Joined:
1 week, 3 days ago
Email:
m*************@gmail.com

Posts by horsedog

<prev • 8 results • page 1 of 1 • next >
4
votes
2
answers
121
views
2
answers
Need the first and the third element after doing strsplit
... I have a quick question about to extract the the first and the third element after doing the strsplit in R, here is the example: Bacteroides oleiciplenus YIT 12058 what I need is Bacteroides YIT What I can do with it? I only know how to extract the first one using "head,1" Thank you very much ...
R written 2 days ago by horsedog20 • updated 2 days ago by cpad01121.9k
0
votes
0
answers
108
views
0
answers
Extract the 'phylum' and 'species' under "classification" using Taxize package in R
... I have a bunch of bateria and I want to know their taxanomic name, here I use **Taxize** package in R and got the "table" of taxanomy, due to the format problem here I'm not able to show it clearly, but for example it's like there are three titles for three columns naming "**name**", "**rank**" and ...
R written 8 days ago by horsedog20
0
votes
2
answers
116
views
2
answers
Comment: C: How to add the suffix if the entries are the same in fasta file
... Thank you very much! ...
written 10 days ago by horsedog20
1
vote
3
answers
178
views
3
answers
Comment: C: If it's possible for R detecting the reverse compliment sequence?
... they don't have ATG as the beginning codon but with CAT in the end. ...
written 10 days ago by horsedog20
0
votes
2
answers
116
views
2
answers
Comment: A: How to add the suffix if the entries are the same in fasta file
... before the name there is a ">" so it's like this > Rhodobacter_sphaeroides_2.4.1_chromosome_2 ...
written 10 days ago by horsedog20
0
votes
2
answers
116
views
2
answers
How to add the suffix if the entries are the same in fasta file
... I got a bunch of genome sequences in the same fie named *sequence.fasta* but some of them have the exact same names, like this: > Rhodobacter_sphaeroides_2.4.1_chromosome_2 ATGAGCTTTCCCCATTTCGCGGCCCTCTTCCGGCCCTCGCAGTTCTTCGGCATCCGCGGCGGCGTCCACCCCGAGACGCG >Rhodobacter_sphaeroides_2 ...
gene sequencing written 10 days ago by horsedog20 • updated 10 days ago by Brian Bushnell14k
4
votes
3
answers
178
views
5 follow
3
answers
If it's possible for R detecting the reverse compliment sequence?
... Here I got a lot of targeted sequences in one fasta file and I need to align them, but some of them are reverse compliment sequence, is there any way to detect them once and reverse compliment them? Thanks. ...
R sequencing written 10 days ago by horsedog20 • updated 9 days ago by VHahaut940
8
votes
6
answers
231
views
7 follow
6
answers
Rename the fasta entries in Unix or R
... I'd like to change the entries of each fasta file from: gi|556503834|ref|NC_000913.3|Escherichia coli str. K-12 substr. MG1655, complete genome to: Escherichia_coli_str._K-12_substr._MG1655 which means i want to remove the accession number and just want to keep the species name, at ...
genome R written 10 days ago by horsedog20 • updated 10 days ago by cpad01121.9k

Latest awards to horsedog

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 748 users visited in the last hour