User: lech.kaczmarczyk

New User
Last seen:
1 year, 7 months ago
3 years, 5 months ago

Posts by lech.kaczmarczyk

<prev • 31 results • page 1 of 4 • next >
Comment: C: Demultiplexing and deduplicating using barcodes and UMIs in the "mate" read
... Sorry, maybe I was not clear (or it is me, who simply don't get it): My barcode+UMI will be located just upstream of the following primer: **Multiplexing Read 2 Sequencing Primer 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT** In such a case,. I get the barcode+UMI sequence in the first 8 cycles. Isn't t ...
written 21 months ago by lech.kaczmarczyk50
Comment: C: Demultiplexing and deduplicating using barcodes and UMIs in the "mate" read
... My plan is to sequence only UMI and index using read2 (Reverse), so 8-9 cycles. Is there a problem with that? If this is for some reason (cost) inefficient approach, please let me know. ...
written 21 months ago by lech.kaczmarczyk50
Comment: C: RNA half-life calculation using SlamDunk
... Hi Caleb, I'd like to embark on using SLAM-seq. I was wondering if you made any progress with the half-life calculations in R? Cheers, Lech ...
written 21 months ago by lech.kaczmarczyk50
Comment: C: Demultiplexing and deduplicating using barcodes and UMIs in the "mate" read
... Barcodes embedded in the gene specific RT primers containing partial illumina adapters, below is the example (UMI and barcodes in bold). I don't have the reads yet as I'd like to have the strategy thought-through before starting. The experiment is aimed at assessing T->C conversions (SLAMseq) wit ...
written 21 months ago by lech.kaczmarczyk50
Comment: C: Demultiplexing and deduplicating using barcodes and UMIs in the "mate" read
... Thanks a lot, this is very informative. As this is not scRNAseq, and the barcodes represent individual samples, separate BAM per barcode would be ideal. I was also thinking about using FastX barcode splitter, after combining the pairs into one read after trimming, etc. Will try your solution! ...
written 21 months ago by lech.kaczmarczyk50
Demultiplexing and deduplicating using barcodes and UMIs in the "mate" read
... Hi All, I'd like to demultiplex and deduplicate reads using in-line barcodes from read2 and UMIs from the read1 and read2. The format is like this (read2 is a short read, containing only barcode and UMI). 1: UMI-primer-READ 2: barcode-UMI UMI-tools seems to be suitable, but I failed to find how t ...
next-gen rna-seq demultiplexing written 21 months ago by lech.kaczmarczyk50 • updated 21 months ago by i.sudbery11k
Comment: C: QSEA package - Enrichement parameters choice (addEnrichmentParameters)
... Thanks for that. Yes, I read that, but found it somehow not exhausting the topic. Sorry for my lack of understanding. ...
written 3.3 years ago by lech.kaczmarczyk50
R package (or other software) allowing to save a biological network in GPML format
... I would like to import a custom made pathway into Pathvisio. It only accepts GPML format. Is there any R package containing a relevant export function that I could use? Cheers, Lech ...
gpml cytoscape written 3.3 years ago by lech.kaczmarczyk50 • updated 3.3 years ago by Jean-Karim Heriche24k
QSEA package - Enrichement parameters choice (addEnrichmentParameters)
... Hi All, I am using QSEA to analyze MeDIP data. I am stuck on the step where enrichment parameters need to be defined (FUN `addEnrichmentParameters`). To get the rough idea about the data, I input the defaults. But now I would like to make sure they are the right choice. To quote the help of the FUN: ...
medips qsea methylation medip written 3.3 years ago by lech.kaczmarczyk50
Comment: C: Cytoscape - "Ontology and Annotation" import window not opening
... Thanks a bunch, good to know. ...
written 3.4 years ago by lech.kaczmarczyk50

Latest awards to lech.kaczmarczyk

Popular Question 2.6 years ago, created a question with more than 1,000 views. For ENSEMBL IDs 2 Entrez Gene IDs - what to do if no match?
Popular Question 2.6 years ago, created a question with more than 1,000 views. For cell type-specific miRNA analysis and miRNA-mRNA expression correlation


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1895 users visited in the last hour