User: tianjunz

gravatar for tianjunz
tianjunz0
Reputation:
0
Status:
New User
Last seen:
2 years, 6 months ago
Joined:
2 years, 7 months ago
Email:
t*******@umich.edu

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by tianjunz

<prev • 2 results • page 1 of 1 • next >
0
votes
0
answers
820
views
0
answers
Comment: C: Score doesn't match alignment problem BWA-MEM
... Thanks for replying. This is the specific read I am looking at: chr20 0 chr20 13588261 1 8S75M2I15M * 0 0 AAGGAAGGGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGCAGGAAGGAAGAGAAAGAAAAGGAAGGAAGGAAGGAAATGGAAGGAAGGAATGT 22222222222222222222222222222222222222 ...
written 2.6 years ago by tianjunz0 • updated 2.6 years ago by genomax84k
0
votes
0
answers
820
views
0
answers
Score doesn't match alignment problem BWA-MEM
... Hi everyone, I am recently using BWA-MEM for aligning human genome. I found that when a hit (hit A) with a higher score falls in a the extension of another hit (hit B) which computed previously, BWA-MEM doesn't do the extension for hit A. However, on the final output, BWA-MEM uses the alignment for ...
alignment bwa written 2.6 years ago by tianjunz0 • updated 2.6 years ago by Friederike5.7k

Latest awards to tianjunz

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 930 users visited in the last hour