User: manishbiotechie

New User
Last seen:
5 months, 4 weeks ago
1 year, 4 months ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by manishbiotechie

<prev • 4 results • page 1 of 1 • next >
Comment: C: split all fasta sequences in a multi fasta file from half into two sequences
... I know how to split a big fasta files into multiple fasta files but my query is to bisect all fasta nucleotide sequences in a fasta file into two halves e.g. >TC93917 GGCACGAGGCAGAAACCAATTTCAAAACATTATATAAATAGCTAGTTTCAGTACTAGCTG TGCAACTCAATTATAGAACAATGGCTTCCTCTATGATCTCCTCTTCAGCTATCACT ...
written 6 months ago by manishbiotechie0 • updated 6 months ago by bioExplorer3.7k
split all fasta sequences in a multi fasta file from half into two sequences
... Hi i have a fasta file with many fasta sequences and I want to split all the fasta sequences into two half from middle.. I am new to bioinformatics kindly suggest some tool or perl command ...
sequence written 6 months ago by manishbiotechie0
modify gff file
... Hi I want to modify my GFF file Right now it is in form Ca_LG_1 EVM gene 41278 42503 . - . ID=Ca_00005; Ca_LG_1 EVM mRNA 41278 42503 . - . ID=Ca_00005.1;Parent=Ca_00005; Ca_LG_1 EVM exon 42292 42503 . - . ID=Ca_00005.1.exon1;Parent=Ca_00005.1; Ca_LG_1 EVM CDS 42292 42503 . - 0 ID=C ...
genome written 7 months ago by manishbiotechie0 • updated 7 months ago by finswimmer11k
how to parse raw reads to unique reads with count for fast alignment
... i want to parse raw reads to unique reads with count for fast alignment for use in mirdp. suggest some pipelines except ...
next-gen rna-seq written 16 months ago by manishbiotechie0 • updated 16 months ago by Malcolm.Cook1.0k

Latest awards to manishbiotechie

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1329 users visited in the last hour