User: manishbiotechie

Reputation:
0
Status:
New User
Last seen:
5 months, 3 weeks ago
Joined:
2 years ago
Email:
m**************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by manishbiotechie

<prev • 6 results • page 1 of 1 • next >
0
votes
1
answer
214
views
1
answers
Comment: A: convert unique tags to fasta
... its not taking the right format i have asked question in fasta format but some error is there while posting ...
written 5 months ago by manishbiotechie0
0
votes
1
answer
214
views
1
answer
convert unique tags to fasta
... I have a large fasta file of microRNA where unique tag is there in form of >sequence1_x5 AGCTAGCTAGCTAGCT >sequence2_x15 ATCTATCTATCT and i want to convert into individual fasta file as >1 AGCTAGCTAGCTAGCT >2 AGCTAGCTAGCTAGCT >3 AGCTAGCTAGCT ...
rna-seq written 5 months ago by manishbiotechie0 • updated 5 months ago by SMK1.9k
0
votes
0
answers
495
views
0
answers
Comment: C: split all fasta sequences in a multi fasta file from half into two sequences
... I know how to split a big fasta files into multiple fasta files but my query is to bisect all fasta nucleotide sequences in a fasta file into two halves e.g. >TC93917 GGCACGAGGCAGAAACCAATTTCAAAACATTATATAAATAGCTAGTTTCAGTACTAGCTG TGCAACTCAATTATAGAACAATGGCTTCCTCTATGATCTCCTCTTCAGCTATCACT ...
written 15 months ago by manishbiotechie0 • updated 15 months ago by lakhujanivijay4.7k
1
vote
0
answers
495
views
0
answers
split all fasta sequences in a multi fasta file from half into two sequences
... Hi i have a fasta file with many fasta sequences and I want to split all the fasta sequences into two half from middle.. I am new to bioinformatics kindly suggest some tool or perl command ...
sequence written 15 months ago by manishbiotechie0
2
votes
1
answer
510
views
1
answer
modify gff file
... Hi I want to modify my GFF file Right now it is in form Ca_LG_1 EVM gene 41278 42503 . - . ID=Ca_00005; Ca_LG_1 EVM mRNA 41278 42503 . - . ID=Ca_00005.1;Parent=Ca_00005; Ca_LG_1 EVM exon 42292 42503 . - . ID=Ca_00005.1.exon1;Parent=Ca_00005.1; Ca_LG_1 EVM CDS 42292 42503 . - 0 ID=C ...
genome written 16 months ago by manishbiotechie0 • updated 16 months ago by finswimmer13k
0
votes
1
answer
644
views
1
answer
how to parse raw reads to unique reads with count for fast alignment
... i want to parse raw reads to unique reads with count for fast alignment for use in mirdp. suggest some pipelines except mapper.pl ...
next-gen rna-seq written 2.1 years ago by manishbiotechie0 • updated 2.1 years ago by Malcolm.Cook1.1k

Latest awards to manishbiotechie

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 903 users visited in the last hour