User: Sureshkumar V.

Reputation:
0
Status:
New User
Scholar ID:
Google Scholar Page
Last seen:
1 week, 4 days ago
Joined:
1 year, 9 months ago
Email:
s***************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Sureshkumar V.

<prev • 5 results • page 1 of 1 • next >
0
votes
1
answer
744
views
1
answers
Comment: C: Fastq_quality_filter: found invalid nucleotide sequence
... Ok, egeulgen, I will try and let you know. ...
written 18 months ago by Sureshkumar V.0
1
vote
1
answer
744
views
6 follow
1
answer
Fastq_quality_filter: found invalid nucleotide sequence
... I am trying to filter reads(Illumina data - RNA-Seq) based on the quality of 30 using the fastx toolkit. But I got an error like this. fastq_quality_filter: found invalid nucleotide sequence (GCGGAGWAACCGTTCGGCEACCAGGTGGCATCGCCGCCGAGGGWGCTCCCGTGGCGCGGGCAGTCGTTGACGAACATCTC) on line 85766. How to re ...
assembly ngs rna-seq written 18 months ago by Sureshkumar V.0 • updated 18 months ago by Sej Modha4.4k
0
votes
1
answer
472
views
1
answers
Comment: C: Pileup file error
... Sir, When I saw using IGV. The Variant Positions has mapped to reads. I followed your parameters to make pileup file. I got the result, but It shows 0 reads in the position. Why does it show like this? ...
written 19 months ago by Sureshkumar V.0
0
votes
1
answer
472
views
1
answer
Pileup file error
... Hi, I am working on the genome assembly. A sequence length 1216bp. Reads fully mapped on that region. When I am creating pileup file using samtools, I got only 1034bp. How to clarify this problem? Thanks in advance ...
assembly ngs snp written 19 months ago by Sureshkumar V.0 • updated 19 months ago by Devon Ryan91k
3
votes
1
answer
1.2k
views
1
answer
How to create consensus from bam file without IUPAC code?
... Hello, I am working in Genome assembly(Reference Guided), I want to create consensus sequence from bam file.I tried bcftools and vcf-consensus. But, I got some IUPAC code. I want consensus sequence without IUPAC Code. Reads: ATGC**A**TGCATGC ATGC**G**TGCATGC ATGC**A**TGCATGC Consensus: ATGC**R ...
genome assembly sequence written 21 months ago by Sureshkumar V.0 • updated 8 months ago by DNAngel30

Latest awards to Sureshkumar V.

Popular Question 13 months ago, created a question with more than 1,000 views. For How to create consensus from bam file without IUPAC code?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1184 users visited in the last hour