User: Sureshkumar V.

New User
Last seen:
6 days, 19 hours ago
6 months, 2 weeks ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Sureshkumar V.

<prev • 5 results • page 1 of 1 • next >
Comment: C: Fastq_quality_filter: found invalid nucleotide sequence
... Ok, egeulgen, I will try and let you know. ...
written 3 months ago by Sureshkumar V.0
6 follow
Fastq_quality_filter: found invalid nucleotide sequence
... I am trying to filter reads(Illumina data - RNA-Seq) based on the quality of 30 using the fastx toolkit. But I got an error like this. fastq_quality_filter: found invalid nucleotide sequence (GCGGAGWAACCGTTCGGCEACCAGGTGGCATCGCCGCCGAGGGWGCTCCCGTGGCGCGGGCAGTCGTTGACGAACATCTC) on line 85766. How to re ...
assembly ngs rna-seq written 3 months ago by Sureshkumar V.0 • updated 3 months ago by Sej Modha2.9k
Comment: C: Pileup file error
... Sir, When I saw using IGV. The Variant Positions has mapped to reads. I followed your parameters to make pileup file. I got the result, but It shows 0 reads in the position. Why does it show like this? ...
written 4 months ago by Sureshkumar V.0
Pileup file error
... Hi, I am working on the genome assembly. A sequence length 1216bp. Reads fully mapped on that region. When I am creating pileup file using samtools, I got only 1034bp. How to clarify this problem? Thanks in advance ...
assembly ngs snp written 4 months ago by Sureshkumar V.0 • updated 4 months ago by Devon Ryan81k
How to create consensus from bam file without IUPAC code?
... Hello, I am working in Genome assembly(Reference Guided), I want to create consensus sequence from bam file.I tried bcftools and vcf-consensus. But, I got some IUPAC code. I want consensus sequence without IUPAC Code. Reads: ATGC**A**TGCATGC ATGC**G**TGCATGC ATGC**A**TGCATGC Consensus: ATGC**R ...
genome assembly sequence written 6 months ago by Sureshkumar V.0 • updated 6 months ago by toralmanvar350

Latest awards to Sureshkumar V.

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 625 users visited in the last hour