User: ste.lu

gravatar for ste.lu
ste.lu40
Reputation:
40
Status:
New User
Location:
Last seen:
6 days, 7 hours ago
Joined:
1 year, 3 months ago
Email:
s**************@gmail.com

Posts by ste.lu

<prev • 36 results • page 1 of 4 • next >
0
votes
0
answers
161
views
0
answers
Comment: C: Visualize BEDPE file
... I was trying to use Rcircos and BioCircos, But I think I can't zoom in as much as I want, in terms of chromosomal region. Is it different for Circos? ...
written 7 weeks ago by ste.lu40
0
votes
0
answers
161
views
0
answers
Visualize BEDPE file
... Hi All, I have a bedpe file resulting from an HiC experiment. the structure is like this: `Chr_bait \t Start_bait \t End_bait \t Chr_target \t Start_target \t End_target \t Notes \t Stat_value` Currently I am visualising them on IGV and they looks likes arches that link the 2 regions (Bait to Ta ...
bed hic igv written 8 weeks ago by ste.lu40
2
votes
0
answers
122
views
0
answers
Comment: C: Group and merge entries in a table according to a second one
... Bedtools was the easier!! bedtools intrestect -a table1 -b table2 -wa > table3 and then filter table 3 for the repetitive entries awk '!a[$0]++' table3 ...
written 3 months ago by ste.lu40
5
votes
0
answers
122
views
0
answers
Group and merge entries in a table according to a second one
... Hi All, I have two tables so structured: Table1: chr1 1 16007 8899 chr1 16008 24571 294334 chr1 24572 27981 192966 chr1 27982 30429 708562 chr1 30430 32153 610786 chr1 32154 32774 837824 chr1 32775 37752 177990 ch ...
R next-gen assembly written 3 months ago by ste.lu40
0
votes
0
answers
172
views
0
answers
Comment: C: from GWAS to variants
... But how can I select the SNPs for a trait? ...
written 3 months ago by ste.lu40
0
votes
0
answers
172
views
0
answers
from GWAS to variants
... Hi All, Are you aware of a database or a way to help me in this task: Given a set of ~100 GWAS, how can I collect all the lead and tag SNPs called in these studies and merge them in a big tsv? What I've done so far was download from EBI GWAS catalog all the GWAS I am interestes in. In this file I ...
gwas snp written 3 months ago by ste.lu40
0
votes
1
answer
284
views
1
answers
Comment: C: Split a sequence in a fastq file
... yeah, definetly. Thanks! ...
written 4 months ago by ste.lu40
0
votes
1
answer
284
views
1
answers
Comment: C: Split a sequence in a fastq file
... Hi Pierre, Thanks for your script! In this way I keep all the reads, the original one and the 2 derived, isn't it? ...
written 4 months ago by ste.lu40
0
votes
1
answer
284
views
1
answers
Comment: C: Split a sequence in a fastq file
... Thank for your answer. I've coded a bit my background is different. What would you suggest? a link to out me on the right track is more than enough. ...
written 4 months ago by ste.lu40
5
votes
1
answer
284
views
5 follow
1
answer
Split a sequence in a fastq file
... Hi All, Could you suggest a way to split a read in a fastq file (on a particular motif) and keep the 2 resulting sequences as 2 independent reads? I'll give an example of what I want to do: > @K00252:388:H2LM2BBXY:3:1101:1397:1138 1:N:0:ATCACG TGTGACCTTCAGGACAGTCCTAAGGCTGTGGGAAAAACACTNAAAACATG ...
sequence fastq next-gen sequencing written 4 months ago by ste.lu40 • updated 4 months ago by Pierre Lindenbaum117k

Latest awards to ste.lu

Popular Question 3 months ago, created a question with more than 1,000 views. For Install Bowtie2 on Windows 10 Home edition

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2130 users visited in the last hour