User: josh.cutts1

gravatar for josh.cutts1
Reputation:
0
Status:
New User
Last seen:
4 days, 14 hours ago
Joined:
4 months ago
Email:
j**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by josh.cutts1

<prev • 14 results • page 1 of 2 • next >
0
votes
1
answer
157
views
1
answers
Answer: C: Concatenate fastq.gz - less reads after concatenation than before?
... Arg sorry! I made a mistake that I can't reproduce. I tried to recreate the problem and it has gone away and everything adds up correctly. I just have less reads than our sequencing provider said we would but the counts add up in the individual files so I need to follow up with them. Thanks for y ...
written 10 weeks ago by josh.cutts10
1
vote
1
answer
157
views
1
answer
Concatenate fastq.gz - less reads after concatenation than before?
... Forgive the silly question but I'm having a problem with concatenation that is driving me a little mad. I have a sequencing run with reads for each sample spread across multiple lanes. So I wanted to concatenate them before proceeding with mapping and further downstream analysis. I looked up how t ...
next-gen chip-seq sequencing written 10 weeks ago by josh.cutts10
0
votes
0
answers
458
views
0
answers
Comment: C: fastqc "Too many tiles (>500) so giving up trying to do per-tile qualities since
... It is from a Novaseq, could you please tell me how you knew that it was 2-color chemistry data? The facility that did the sequencing did have a fluidics issue that was resolved and I wasn't informed about any issues with the quality of the run from this data. The 5 other samples in this pool all ap ...
written 3 months ago by josh.cutts10
0
votes
0
answers
458
views
0
answers
Comment: C: fastqc "Too many tiles (>500) so giving up trying to do per-tile qualities since
... @A00140:10:H25M5DMXX:1:1101:7871:1000 1:N:0:ATGCCTAA NATAATGGAATAGGAATTATTTTGATGAATTATAAATTCTGGGAGGGTGGTGGGGGATCAGGAGGACCTTAGTGAGTCCTCACAGTTTTTATATTTCATCAAATTAATTCCTTTTGCGTTAGTAGATCGGTGGAGCAGTCGGCGGTACTCC + #FFFFFFFFFFFFFFFFFFFFFFF-FFF--F-FFF---FF----FF--F--F-FFF--F-FF-FF-F----F-F-F- ...
written 3 months ago by josh.cutts10
0
votes
0
answers
458
views
0
answers
Comment: C: fastqc "Too many tiles (>500) so giving up trying to do per-tile qualities since
... Thanks, sorry I wasn't more clear. I'm just trying to determine if I was doing something obviously wrong with fastqc or if this notification indicates that something is wrong with the file itself? I'm concerned that my per-base quality looks quite similar to the fastqc fail per-base quality (where ...
written 3 months ago by josh.cutts10
0
votes
0
answers
458
views
0
answers
Comment: C: fastqc "Too many tiles (>500) so giving up trying to do per-tile qualities since
... Thanks, yes I did just update to the most recent version of FastQC (11.7) to try to fix the error. ...
written 3 months ago by josh.cutts10
1
vote
0
answers
458
views
0
answers
fastqc "Too many tiles (>500) so giving up trying to do per-tile qualities since we're probably parsing the file wrongly"
... I have some fastq files from a ChIP-seq run that I'm trying to run on fastqc but I keep getting this notification partway through the analysis: $ fastqc -nogroup FB_BcatIP_R1_001_trim.fastq Started analysis of FB_BcatIP_R1_001_trim.fastq Approx 5% complete for FB_BcatIP_R1_001_trim.fast ...
qc fastqc written 3 months ago by josh.cutts10
0
votes
0
answers
467
views
0
answers
Comment: C: HOMER annotatePeaks - No Annotations
... I tried to set the MAPQ thereshold high for the mapping as you recommended and go through the same pipeline but again there were no annotations. I went back again and tried to change the chromosome column from the Homer peak file (column 2) from just "numbers" to chr"numbers" as it is in the annota ...
written 3 months ago by josh.cutts10
0
votes
0
answers
467
views
0
answers
Comment: C: HOMER annotatePeaks - No Annotations
... I've just tried creating tag directories with the sorted and indexed bam files and using these to call peaks using findPeaks, then used the peaks file to annotate using annotatePeaks but have the same problem, none of the peaks are being annotated. ...
written 3 months ago by josh.cutts10
0
votes
0
answers
467
views
0
answers
Comment: C: HOMER annotatePeaks - No Annotations
... Thanks for the quick reply. Just to clarify: after sorting and removing PCR duplicates I should use the sorted bam files to make the tag directories to call peaks against? ...
written 3 months ago by josh.cutts10

Latest awards to josh.cutts1

Scholar 10 weeks ago, created an answer that has been accepted. For C: Concatenate fastq.gz - less reads after concatenation than before?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1591 users visited in the last hour