User: bgbrink

gravatar for bgbrink
bgbrink20
Reputation:
20
Status:
New User
Location:
Last seen:
1 week, 2 days ago
Joined:
9 months, 1 week ago
Email:
b************@gmail.com

Posts by bgbrink

<prev • 8 results • page 1 of 1 • next >
0
votes
0
answers
71
views
0
answers
Can I create a GAF file from gff3?
... I need to create a GAF file for a non model organism. Currently I have a reference.fa and a gff3 with predicted genes. How can I map those to GO terms and create a GAF file according to these specifications: http://www.geneontology.org/page/go-annotation-file-gaf-format-10 Google only brought up B ...
genome annotation assembly written 4 weeks ago by bgbrink20
2
votes
0
answers
208
views
0
answers
Tools for annotating UTRs
... Hello everyone, I have high quality sequencing data, as well as RNA-seq data. We successfully assembled a de novo genome, however the automatic gene prediction (e.g. with AUGUSTUS) does not give any information about the UTRs. I think using the RNA-seq data it should be possible to annotate many of ...
genome assembly sequencing written 3 months ago by bgbrink20
0
votes
0
answers
175
views
0
answers
Does the PacBio basecaller filter out reads with low complexity?
... I have data set where the genome is known to contain about 10% telomeric repeats. However, when I blast a sequence of 4 x TTAGGG against my reads, less than 1% show a hit. This makes me wonder if reads with low complexity are removed by the basecalling pipeline and don't end up in the subreads.fastq ...
sequencing written 7 months ago by bgbrink20
0
votes
3
answers
887
views
3
answers
Comment: C: Fastq files with integer instead of acii quality scores
... That could be it. I don't have any hard proof from what technology this data is from though. Does it still make sense to try and convert the scores manually? ...
written 9 months ago by bgbrink20
0
votes
1
answer
785
views
1
answers
Comment: C: PacBio interpulse duration (IPD) data
... Thanks, this was really helpful. As I mentioned in my original post, I have RSII data available. Thus, I could not use SMRT Link. However, I was able to run the old SMRT analysis on my laptop. ...
written 9 months ago by bgbrink20
8
votes
3
answers
887
views
7 follow
3
answers
Fastq files with integer instead of acii quality scores
... I was going to align a bunch of old fastq files with bwa and got no result. When I looked into the files, I saw that the base quality is reported as integers as opposed to ascii: @1_21_9:1:2:1565:591 GTGTTGTTTAGAAGCTGAACTACCTTTTTCGCTGAG +1_21_9:1:2:1565:591 40 40 40 40 40 40 40 40 ...
sequencing written 9 months ago by bgbrink20 • updated 5 months ago by liartom210
0
votes
1
answer
785
views
1
answers
Comment: C: PacBio quick start guide
... I did see the training, but it was not very helpful, since most of it is tailored to PacBio's SMRT Portal/SMRT Link platform (what's the difference anyway?). I will have another look though, since I also missed the python script you mentioned. Thanks a lot for pointing that out! ...
written 9 months ago by bgbrink20
7
votes
1
answer
785
views
8 follow
1
answer
PacBio interpulse duration (IPD) data
... I started working on my first project with PacBio sequencing data, and after 2 days filled with fruitless googling, missing libraries and failed c compilations, I decided it's time to ask for help. The information on tools and pipelines for PacBio data is scattered everywhere and most of it seems h ...
software error next-gen alignment sequencing written 9 months ago by bgbrink20 • updated 7 months ago by yangxiaofeihe0

Latest awards to bgbrink

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1745 users visited in the last hour