User: bgbrink

gravatar for bgbrink
bgbrink10
Reputation:
10
Status:
New User
Location:
Last seen:
2 hours ago
Joined:
3 months, 2 weeks ago
Email:
b************@gmail.com

Posts by bgbrink

<prev • 6 results • page 1 of 1 • next >
0
votes
0
answers
76
views
0
answers
Does the PacBio basecaller filter out reads with low complexity?
... I have data set where the genome is known to contain about 10% telomeric repeats. However, when I blast a sequence of 4 x TTAGGG against my reads, less than 1% show a hit. This makes me wonder if reads with low complexity are removed by the basecalling pipeline and don't end up in the subreads.fastq ...
sequencing written 7 weeks ago by bgbrink10
0
votes
2
answers
306
views
2
answers
Comment: C: Fastq files with integer instead of acii quality scores
... That could be it. I don't have any hard proof from what technology this data is from though. Does it still make sense to try and convert the scores manually? ...
written 3 months ago by bgbrink10
0
votes
1
answer
379
views
1
answers
Comment: C: PacBio interpulse duration (IPD) data
... Thanks, this was really helpful. As I mentioned in my original post, I have RSII data available. Thus, I could not use SMRT Link. However, I was able to run the old SMRT analysis on my laptop. ...
written 3 months ago by bgbrink10
4
votes
2
answers
306
views
5 follow
2
answers
Fastq files with integer instead of acii quality scores
... I was going to align a bunch of old fastq files with bwa and got no result. When I looked into the files, I saw that the base quality is reported as integers as opposed to ascii: @1_21_9:1:2:1565:591 GTGTTGTTTAGAAGCTGAACTACCTTTTTCGCTGAG +1_21_9:1:2:1565:591 40 40 40 40 40 40 40 40 ...
sequencing written 3 months ago by bgbrink10 • updated 3 months ago by sacha1.2k
0
votes
1
answer
379
views
1
answers
Comment: C: PacBio quick start guide
... I did see the training, but it was not very helpful, since most of it is tailored to PacBio's SMRT Portal/SMRT Link platform (what's the difference anyway?). I will have another look though, since I also missed the python script you mentioned. Thanks a lot for pointing that out! ...
written 3 months ago by bgbrink10
7
votes
1
answer
379
views
8 follow
1
answer
PacBio interpulse duration (IPD) data
... I started working on my first project with PacBio sequencing data, and after 2 days filled with fruitless googling, missing libraries and failed c compilations, I decided it's time to ask for help. The information on tools and pipelines for PacBio data is scattered everywhere and most of it seems h ...
software error next-gen alignment sequencing written 3 months ago by bgbrink10 • updated 8 weeks ago by yangxiaofeihe0

Latest awards to bgbrink

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1847 users visited in the last hour